DY258041

Overview
NameDY258041
Unique NameDY258041
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length787
Libraries
Library NameType
AbsCOv1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionKN0AAB2DA05ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY258041 ID=DY258041; Name=DY258041; organism=Citrus clementina; type=EST; length=787bp
ACTGCAAATAGATTTTTGCCAGTCTATCTCTTATGGTCATTAATTGACCA
CAACTCTCTTCAATTCTGTTATATCTTATCAGACACATTTTGTGTTTTAA
ATACAAATAATTCAATTCACTTCCATTTTTCCCATTTCACCTTCGAAGTT
TTTATTATTCTTCAAAAATGGCAAGCATTAAACTATGCAACTTTGTCCTC
CTACTACTACTCGTACAACTTCTTGCTCCTGCTTATGTTGTAGTACAAGG
GTCTAGAACTCAAGTGGGAATTCCTCGTCATCAAAGCTTCTCTCCTTCAT
CTCCTGTTCATTTCAAGGAAAGCAGTAAAGCAAAGGTAATGAATAGGAAT
TCAAGAAGATTGATGATTGGATCGACAGCACCAACTTGCACTTATAATGA
GTGTAGAGGTTGCAAATACAAGTGTAGAGCTGAACAAGTTCCAGTTGAAG
GAAACGACCCTATCAACAGTGCTTACCATTATAAATGTGTGTGTCATAGG
TAATTAATTAATTAATAATCAGTTACTGGCTAGCTAGATCAAAAATTTTA
TTAATTAATTGTAAGGTCGTTTTGATGGTTTAGCTTTTGAATCGAAAAGT
CATGGAGTTGGTATCCTCTTACAATCCAACTCTGGTTTTTGTCTGAACAA
CTAGCTAGTTAGAATGTTATTACATGAGTATTAATTCACGTTCGTCGGTA
GTGTCCATTTTGACGCACATAAATTTTCAGCTATTCGATTATGTCATGCA
AATCGAGTTTTCTTGAAGAAAAATATCATCAATTAAC
back to top