DY258042

Overview
NameDY258042
Unique NameDY258042
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length653
Libraries
Library NameType
AbsCOv1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAB2DA08ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY258042 ID=DY258042; Name=DY258042; organism=Citrus clementina; type=EST; length=653bp
GCCACCTTGACCCAGTCAAATTTTGTTAAAATCACGTAAAATTTGCGTCA
AATCTTCACATCTTTAACAATTTCGCGAAATCGGGAACATCCTTTATTAC
TCGGGCGATCATTTCAAAATGGGGTTAAGGGAAAACCCGGTTTGTAACCA
AAATCAACTACTTGGAACCTGCACCCCTTTCTCCAAGGGGAAAAAACGAA
AAAGCGGGGCACGGGCCCCCTTTCCACCATTCCCCACCCGAATGGGTAGG
GGAAAAGGGACCCTTAAAAATTTAGTTGAAACCCCCATAGAATTTTCCGA
AATCCCCCCTTTTTTTTAAACACCGGCGCCAAAACCGCGAAAACCCTCTA
AAAAAACAAAAAAAACCGGGGGAAGGGGGGGGGGTGTGTTTTTTTTGGGG
AAACAAAGCCCCCCCATTTAAAAAAACCCGCCCCCTCCCCCCCCAGAGGA
GGAAACCCCCCTTGGGGGGGGGGGAGGGTCCCCCCTACCCACGACCCCCC
CCCCTCTCTATTTTTTTTTTGTGTGGTGGGGGGGGGTGGGCGCGGAGAAA
CCAACAAAACAAAAAAAACACCCAAAAAAAAAACCCCCCCCCCCCCCCCC
CCTTTTTTTTTTCTTTCTTTCTGGGGCGACAAAAACACAGCCCCGCGCCG
GCG
back to top