DY258296

Overview
NameDY258296
Unique NameDY258296
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length1376
Libraries
Library NameType
AbsDev1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAI1AC08FM2 AbsDev1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY258296 ID=DY258296|Name=DY258296|organism=Citrus clementina|type=EST|length=1376bp
CATTTCTTGTGATTTTGTAATGCTTTAATACTGGTTAAGATGTTAATTTT
TATTTGATGGCTATGAATTATGAAATGTGTTTATTTTAACTTGATGGGTG
AGAATTTGATTAAATTGTAATTATTAGAGTTTGGGTCAAAAAAGAGCCAG
AAAAAAAAAAGAATAAAGCCGGAAAAAAACTACAAAAAAAAACCAGGATA
TGAAAAAAAGAACATTATACGCCACAACAACAAATTCAAGACGTACATGA
CTTACATCTTTCTGAGTCAAGAAAACGGGTCCATCTCCCACAAACAGAAT
CCCCCACTATGGCCCCGCTGAATCATGAACCAGTTTCTTCCAATCCCATT
ATCAGAGAAGATTGGCCAGGAAGGCTTCTTACGCTGTGCAGGTTACAAAC
CCCATCTCCGAGTAATTATACTCACGGGGAAAAACACACCCGCTTGTGAG
ACTAAGTACTTCCTGTTAGAGCCTGTGAAACCCACGCTGTATTCACGAAG
CTACCTAAATTCTGTTACCTCTATTTACTTGCTACTTGAAGGATCTCTTA
GTTGAAAAAAACGGTGAAATTCCCGATGTCACGTGAACCTCGCGAACTTC
CCCCCTCTACGCCCTGACATTCCCCCACACGAAAACCCCATTCTCACCCT
TTTTGCTTTGCCAACCTCTGAGAACAAACTCTAAGGCTATGAATTGCACC
TCCCCAATAAACTCCACCCCGCCCCCAGATAAACGTCCACGTTTCCTCTC
TGTCCCCACCCCTATCACTCACCCCCGACTCCGGCATTAACCCCTGCCTG
ATCCTTACTCTCAACATCGCCATACGTTATTCGAGAACATTTGCTTGGCG
GCGAAAACACAATAAACTCTCATTTTCTTTTTTTCCAAATAATCAAATAA
ATACAAAAACAAAAATAAAACTACACACCCCACCTTTCTCGCTCACACGC
AACACATATATTCTCAACACCTCTCTAACAAACTACTCCTCTCACTCCCA
AACCACACCCCCCTCTCCCCCAACGCTACACCACACTATATAGTCCCCTC
CTCACCCCCTCCCCTTCCCACAACCTCCATCCCTCTATTAATGGAACACA
AAATACTAATCATTCCTCTCCACCCCCCCCCCTCATCTCCACCAAAATAC
CCCCCCCACTGTTACATTTCTCGTGCCAACCATACCAATACTATTACCCT
CCCTAAATAGATCCAAACAAACCAAACTCTCCCGCCTGATCCTCCCCCCC
ATCTAACACTTAATACTCTCTTCCATCATTTTACTCTACTTCACACCGAA
CCACCACCCCTTACCCCCCCATACTCAACATTAAACTCTTAAAACAAACA
CACGACACCCCATACTCTAATTCCTC
back to top