DY258299

Overview
NameDY258299
Unique NameDY258299
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length233
Alignments
Feature NameTypeLocationAnalysis
DY258299_ssr54 microsatellite DY258299_ssr54:54..65.
Ccv1_Contig8296 contig Ccv1_Contig8296:399..631. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
AbsDev1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAI1AC12FM2 AbsDev1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY258299 ID=DY258299|Name=DY258299|organism=Citrus clementina|type=EST|length=233bp
CTGAAACCGAGCCTCAAAACTGAAGCTCCATAATAAATTTGTATCTGTAT
CTCAATAAATAAATAATCTTGCTTACATTTATGCGATGTAAGCTTCATTC
TGTTTTTCCTTTTTTCTTTGTTTTGTAAGTGCAATGTAAGCTGCTTGTTC
ACAAAAAAAATACTTCTTTTATATAAAAGAAGTATTTATGAATAAATGAG
TACATTTTTAGAAAAAAAAAAAAAAAAAAAAAA
back to top