DY258460

Overview
NameDY258460
Unique NameDY258460
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length1368
Libraries
Library NameType
AbsDev1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAI1DE08FM2 AbsDev1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY258460 ID=DY258460; Name=DY258460; organism=Citrus clementina; type=EST; length=1368bp
TGGTATACATGGATCAAGAATCTTAACCGTTTTCCTTGCCAGTTCTAACA
ATAAAATTTCGGGTGCAGTTTTCTTACATTTCAGTTTTAGAGTGTAGATG
ATAATGGATGTAGTGGATTCTACTTATCCGAGCATTTTGTTATTCATTAA
TGCAATATTAGGTCCTATGGACTTTGTCGAACAAACTCAAAAAAAAAAAA
ATTATGTTTCCCACCCTTCCTAAAGCCCCTACGCATCAATCCAAGCTCAG
CGTACACTTTTACCGACAGGACCGCGCAACCACAGCCCCTCCCCCCCTTC
ACTACATCCCCCCCCTCCACCCCACACCATACTCCTCCCACACGCCACTC
CCAACGTCTCCCTCCCGTCTGCCCGCCCAACCCACCACCCCAGCTTCCCA
TAACACCTATACCCCACTTCCCATACTGCTCCCATTTTTATTCAGCATCG
CTTCATACCCCCCCACGTCTCTCTTCTCCCCACACTCCCCCCCACTATTC
AACACCTGCCCGACCGCCCACCCCAAAACCACCAATATCCCCACCATATA
CCTTCATCCATACTCTTCTTCCTTCCTCTCCCCACCACCACACTACGAAC
ACCCCATCACTCTCACCCTACCCGCCCTCACTTTTCTCAGATCACTCCCC
AACACACCACTTCTCATCCACCCCACTACCCTTTCCCGCACCCCTCCAGA
ACATTCCCCGCCCTCCACCTATATCACCAACACTACAACCCCCTCTCACC
TCTCTGCCCCTCCTCTCCCCCCACATCACGCTTTCCCTTACTCTCCGCCC
AACCCACCACCCCTCTCCCTATCCTCCCGCTTCTCCCTCCCACACTTCCT
TACCTTCATCCATATTCCCCCTCACACCCCAAAACCCCTACTCACACTCC
CCCCCTCCACCAGCTCTCCTCTCCCTCCCACCCATCCATCCCATATACTT
CCCCCACCCCATAAACACTCTACCTCATAAACACACACCATACATCTCAC
ACCTCCTTCTCCACACTCCCTATTCACCATTCCCACCTCCCCCCTCCCTT
CCACCCCCTCTCCCTTCTCTTCCCTCTCACCTCTCATTCATCTTTCCCTT
CCTTTTCCACCCTTCCGCCACTCCTCTCCCCCTCACACTGCCCACCTCCT
AATACACACCCCCNCCCCCTCATTCTCCCCTCCCCTCCTACCAACTACCC
TTCCCCTAACCCCCTCCCCCTACCCACTACAACAAATTATCCTCCACCAC
ACCCCCTTCCCCTCCCCCACATATGCTCCACAACACCTTCACTGCCCACC
TCCCCCACCCTCACCCTGCTCCTAACCTCTCATCATTTTTCTCCTCATCC
CCCAACCCACTCTACCTC
back to top