DY258465

Overview
NameDY258465
Unique NameDY258465
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length233
Libraries
Library NameType
AbsDev1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAI1DF06FM2 AbsDev1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY258465 ID=DY258465; Name=DY258465; organism=Citrus clementina; type=EST; length=233bp
GTTGATACGGAGCCTGAAACCGAGCCTCAAAACTGAAGCTCCATAATAAA
TTTGTATCTGTATCTCAATAAATAAATAATCTTGCTTACATTTATGCGAT
GTAAGCTTCATTCTGTTTTTCCTTTTTTCTTTGTTTTGTAAGTGCAATGT
AAGCTGCTTGTTCACAAAAAAAATACTTCTTTTATATAAAAGAAGTATTT
ATGAATAAATGAGTACATTTTTAGAAAAAAAAA
back to top