DY258469

Overview
NameDY258469
Unique NameDY258469
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length1220
Libraries
Library NameType
AbsDev1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionKN0AAI1DG02FM2 AbsDev1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY258469 ID=DY258469; Name=DY258469; organism=Citrus clementina; type=EST; length=1220bp
CTCCTTTTCCCCCTTCTTACTTTCCCTTTTACCACCACCACCATATCTAA
TTACCTAATATCTAATAAAAGCAACCACCACCAAATATCTCCTATCTCTT
CACTAGCTCAACCTCACTACTATTCTGGCTCTCCCAAGCATGGAAGCTTT
CAGCTTGCTCAAGTACTGGCGCGGCACCGCCGCTGGCGCCGGCTTTGTCA
CTGGTGGCGACGGTGGTGCTACTTTACGCAACACTACCACCACCACTACT
ATTGTGACAGCAGTCAGTACTCACCACGCGGCGGAGGAGACTGACGACGA
CGACGACGACGGCCCCTTTTTCGACTTGGAGTTTGCTGTTCAAGATCAAG
ATGATGAAGCCGAAGAAGATGAAGATGAAGATGATGGAGAAGAACAAGTA
GTTAGCAGAAACAACGGGGACGAAAACGACGACGTTGGCTCTGAAGACGA
AATTACGGACGAAGAAGGAGAGTTCAACTTCACGATTTCTTCTAATTCAA
GCGGCAACGACCGTACGGATCAGCATCTCACCCTCTCTCCGTCCGATGAC
TTGTTCTTTAAAGGAAAGCTTGTGCCTATTGAGCCTTCCTCTCTCGTATT
CAACTCGGCCGCCGAGCCTAATTCCAAGCCGCAATTTCCAGTCTCCCTGT
TGAAATCGGCAACCAAGTTTCGAGTCTCCATGTTAGGTTTCAAAAAAACC
AAACAAAAATGCCACCGAAAAAGTCTCAGAGAAAAACAACGGATCTGTTG
ATACCACTGCGGCCGCCGTTGCTGATACTCCCGCCCCGCCGCCCCCGCCG
ACGAAACAACAACAACAACCGAAACCAGAAGCTGGAAAAGACCACGCAAG
GCAGTTTTTTCCGGGCAAATCCAAGGGGAAGGAAATCCCATTACGGTCCT
GGTCACGAAAAACAACCACCGGTCAAGGGAGTCCCAAAAACCAAATGGTG
AAAAATACAAGGAAAAAAATTCCCCCCAAAATGCCCGCCAAATTTACTGA
AAAAAGGTTAACCCCCTTAACGGGCGAATTTTAAAAACGGAAGTTCCCCG
GGCTATTTAAACTCCGGGGCCCCTCACAAAACCCCCCCCCACCCCCCCCC
CCACAACGGGGGGTAAAAAGCGAAAAAACCCCCAAAAATAACGGGGGGAA
AAAAAAACCCCCCGCGGCCGGGAGGGGGGGGGGGGCCCGGGGGGGGAAAA
CTCTTTTTTGTTTCCCACTC
back to top