DY258474

Overview
NameDY258474
Unique NameDY258474
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length1225
Libraries
Library NameType
AbsDev1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionKN0AAI1DG08FM2 AbsDev1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY258474 ID=DY258474; Name=DY258474; organism=Citrus clementina; type=EST; length=1225bp
GATCTCTTGCACGAATATTTGCTGATCATGCCCGAACAGAAAAATGGGCA
CTCTAACTAGCCAGGATCAGCACATATTAAGGATGTTAATTAGTATCAAC
TTCTGTATTTTTGCTATGATTAAGTTACCTTATTGTATGACTGGAGTCAG
GAGACCATACCTTGCCATTTTCTGCTACTCACATGGAACTTCTGATATAT
GGAGGCAATGCACCTTTTCCCGTTTTTTTTGAAAAAAAAATACTGATGCT
TTTTCCTTTTATTTCATTACACAAAGAAGCTCCTGATCCCGGAAAATCTG
CTCCATTGACGGAACTTCAACATGCATCTATGGACACTGAGTTTCCTTTA
GAAAGCTGGATTCATGTTGGATGCAAGGTTTCTACTGATTCTGTGCAGCT
TCATATTGATGGGGAAATTGTAGCATAGAAGCCTGTGTCTTCATCTTTTT
GTAAAGGTTCCTTGTCAAATTCTCGGACGAGGATAACATTGGTTGGTAGC
AATATGCAGGGTTATGTCCACGATGCAAAAATCTTGCCCCTAAACTTGTC
CATCAAGGATCACTACCATAAGGACCCACCACTTCTATTGTCTATCGATA
CTTCGTCTGCCTCTGAGATTGAAGAAGACAGCGATGGTGTTTGGAGCATT
GTTGGTGGAAAGGCTTCCTGCCCCACGATCTTTTCCTTGGATGTTGTTCT
TTCTAATGCCCTTTGGCCAGCCGTAAACAAAGAAGTGGAAATCCCTGCTG
CCCTTCTGGATGCCGACCATGGCCCCCTTGTCAAGAAGACCAGTGATGGA
CAAACCCCCCCTTTTGACCAGCCTCTGTGGGAACCAATTTCCCTCCTCAT
GACCCGGCCTTTAAACTATTTGACGGGGCGTGCCCCCTTTTAACCCAAAA
ATATCCCCACCTTCCCTCCCAAGGCGACAATACCCCTTTCCCGTTAAAGG
TTTAAATTCCCCAACCCTTGCGGGGTTTCCCTTTTCCAAAAGGTCCCCCC
CAACCCACCCGTTTGTCTCCCAGGAACCCGAAACATCTCGAAAATTCCCT
GCCCCCCTTCAAAAAAACCCATCCTCTCTTCCCCTTCCCCCCAAGGGGCT
TTCCCCCCCCTGGTTTTTTTGTGAAAAGGTTCCTTTTAAAACCTTCCCCC
CCACCCACCGGTCCTTCTGTAACAACAACCCCCCTTCCCCCCCCACCCCA
CGCGGGGGGCAAGGCGGGGGGCACC
back to top