DY258635

Overview
NameDY258635
Unique NameDY258635
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length1267
Libraries
Library NameType
AbsDev1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig5409 contig Ccv1_Contig5409:685..1951. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionKN0AAI2CH12FM1 AbsDev1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY258635 ID=DY258635; Name=DY258635; organism=Citrus clementina; type=EST; length=1267bp
GTTGATAGGTTTGATTTCAGGTGTGAAATCCTGTTGTGGTGATGTAATGT
ATTTGGCTTCAACTACGGTTAACCAGATGTCTGGGCTTGATCAGGTTTCG
GGATACACTTGCTTTTCAAGTGTCTTGCTTCTTTTATTACTGCTTGTCAT
CATGTACCTGTTATTTTAAACATTATATTCATAATGCTTGTGGTTAGTAA
CATTGCATCTCAAATATGGCTTACTCAATGTTGTGTTCTTGATCAGGTTT
CATGATACATTTGCTTTATCCGTGTATTGCTTCTTTTAATAATGCTTTTC
ATCATGTACCTGTTATTTGTAAATTACGTCTCATCTCTTTCTATTCATCA
TGCATGTAATCAATAATATATCTCTTCAATATATCAAAGGGGACTAGATT
TTTTATCTGGGAGCCCAACATTGTTTGCCTCAAGTAATTGTAAAAACAAA
ATCTTATTTATAACTTAGGCCTCTGTGACCGACCACTATCTCACAAAAAA
AATTCGTTGTTTACCATCCCCGTAACTTCCTGGATATTCAGTCTGATATT
AAGCAAAAGGATATTGCGGATGCTATTGGTCCAAAGTTCTCTTCCTGACA
AATGTACAGTTATTCTATACCAATATCATGGCCATGTATATACATGGCCA
TCGTCTTGACTGGAGTACCAACGCTTTTTTCAATACCTGCTCATCACCCA
ACTAAATGTTGAATTGCCATTCCCTTACTGAATCCAAAAATTTCTCCCAG
TTATTACCACATAATTTCTTTATCATGAAAACTTGGGGGGTGTAAAATTT
TCATCCACTACAATACCAACAAATTTAGTTCCCCCCAACGAAATTAAAAT
TTCCCAGCCAGCTTTTGGACCCAGACTGAAAATAAAATCCCTCTCAAAAT
TACCCAACCCTGGAAAAATAATAACTATCCTAAAACAACGGGTTTCCTTT
TAAAAGCCCTGGTGAAAATTACCACCACCCCGAGAAAGGCCCACTTTTTC
CTTGGATTTGCCCAAAGGCAAGGCCACCATTCTTTTTCACAAATTTTAAA
TGGAAAATTTGGCCATGACAATATTTTAAAAAACAAAACTCCCTCCCCCA
CAGGAGGCGCGAAAAACAAAAAAAAAAAACCTCTCCCCAATATGCACCCC
AAGAGTTGCTTATCTCCAAACACAAAAAAAAAAATGGGAATTATTTTCTC
CCGGAAGATAACCCGGTCTGTTGGTGTGGGGGTTAAAACACACCCCAGGA
GACAAAAAATACACAAA
back to top