DY259728

Overview
NameDY259728
Unique NameDY259728
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length693
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig117 contig Ccv1_Contig117:61..753. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Fruit-TFcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAP10YA01FM1 Fruit-TF Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY259728 ID=DY259728|Name=DY259728|organism=Citrus clementina|type=EST|length=693bp
CACTCAATTCTCTTCAGGGTTTCATCAATGGCGCTGTCTCCTCTCATAAC
AGCTCTCCTCTTTGCATTAGCTCTCTCTGCAAGTTTCGAGCTTTCGACAT
GCCAAGAAGTCCTCAAGGGGAAGGTCTCTTGCTCTGACTGCAGCAAGGAC
TATGATCTCTCAGGCGTTAAGGTTCTAGTGAAGTGCAACCATCTCAAGAA
GTTGGCTATGGCGACAACACAGGTTTCAGGCTCCTTCAAGGTTAACCTGC
CATCGGATGCTGCCATGAAAACTCCATCTCCTTTGCACTGCCATGCAAAG
CTATTCGGAGGTCCAGTCCAGCTCTATGCTTCCAAGAAGAACATGGTGTC
CAAAGTCATGAAGCCCAAGAACTCCAACTCATACAAGATCTCAACGCCTC
TTGCATTCTCAATTTCATGTCCATCAAACGTGAAAGATTCAAAATGTGGG
GCAGCAAATAAGTTTGGTTCATCAAAGACCGTTGATCTGCCTTTGCCTCC
AGAGTGGGGCCTTGCACCGTCAAGCTATTATGTTCCTTTCGTCCCTATCA
TTGGAATTCCCTAGTTGCTCACTATTTCTGCGTGTTATATTTTATATTTA
ACATAGTGAGTTTGATTTTCTTGAATATGTTATCATAGTGAGTTTGATTT
TGTTGAATGTGTTATTATATAAATGCTATGTGGCTATATTTTT
back to top