DY259736

Overview
NameDY259736
Unique NameDY259736
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length1290
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig1292 contig Ccv1_Contig1292:1..1290. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
Fruit-TFcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAP10YA14FM1 Fruit-TF Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY259736 ID=DY259736|Name=DY259736|organism=Citrus clementina|type=EST|length=1290bp
ATTGATATCATAATTGTTGCTTTCAAAATGAGGCTTATTGGGTCCTTACT
AATTTTCTCTCTAGTTTTATCTTTTGTACTAGGAGGCTCAGCACAGAACT
GTGGAAGCGGCGTTGTGTACGGTGGACGTGATACCGGCCAAGGGACGCAA
GGCGGTGAACTGGGCAAGATCATCTCAAGGGAGATGCCTGATGGCTCCTC
CTGACTGTTGATAGGATGAACGGTCGCCCTGCCGCAAGCTTCTACACTTA
TGATGCCCCATAATCAAGCTGCCCTCAAGCCCTTTGCAGGTTTTGGCACC
TCTGGAAGTGAATGCATGCCGCTCCCCCCCCCGCCGGCCGTCTTCTGCCA
TACCCCCCCCTGAAACATTACCCCAGTAAACCCCCCCCCTCCGCCCCGCT
CCCTCCAGCCACCCCCCCCTGCACCAGAAACACTTCTCTCGCCCCCCCCC
CCCCCGCCCTGCCTTCTCTACAGCCAACGCCACGCACGAACCTCCCCCTA
ATACGCGCAAGCTAACCATGTGCTTCATCCTAACTCCCCTTCCGACCGCC
CCTCCACCCCCACCCACCCCGCCTTTCGACCACCTTCCCATAAAAAATCA
CCAAACAACGGACTTCACCACCCATTCCAATTCAACATCCCGTCCCTATC
TCCCCCCCCCGCCCCTCCCCCCCCACCCTCCCCCCCCACCTCCTCCACGT
CTACCACACCCCCACTTTACCTCAACCCCCTCACTTACAAAGACTTATAA
CCTCGCGCTCTCCCTCCAAACCTCACCCATCCACCTCCCCCCTCCTTCCC
CCTCCTCACAAAATACGCACTACCGATCGAAAACTCTCACACCGCCAACC
CCACTACCACCAGCATCCCAACCCCCTACACACACCTCTCATTCTACTTC
CCCCACACGAAATATCAGCCATCTCTATTTTCCGTCATCACCCCCCAGCA
TTCTCTCTCGCTTTCCTTATCCACTACCTATCCTCATCTGACCACCAAGA
CCCCTACATCACCAACCACAATCCACACACCAACAACCAACTATCCAATA
CTCACAACATCGAACTACCACCACACCTCAACTAGACAATAATCGNAATC
TATTCACAAATAACTCAACTCAAATAAGCCGCCCGCCTAGCACAGCCAGC
GCCAGCCTGCTACCCACACACTCACCTGCCCCTCCGCTACATAAACAAAT
ACCCCTACCGCCACGCATATTGACGATATCCTAACACCCTCTCACCTCCA
TCCTCCATCTACGTGTCGATTTCNCATTCATCCATGCATA
back to top