DY259740

Overview
NameDY259740
Unique NameDY259740
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length997
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig1294 contig Ccv1_Contig1294:1..997. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Fruit-TFcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAP10YA20FM1 Fruit-TF Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY259740 ID=DY259740|Name=DY259740|organism=Citrus clementina|type=EST|length=997bp
ACCCCGATGTGATTTTGAAGCTGAGTGCTGCAATTTCTGCAATTCTTGAA
AAGAAGCTGTCGGTACCCAAGTCACGATTCTTCATCATGTTTTATGACAC
AAAGGGTTCAAACTTTGGATGGAATGGATCCACCTTCTAGATATTATTCT
CAAAGCATGGCGCCATGAACTCTGACAATTGTCTTATCTATATGGTGATT
ACAATCTTTACAACTATGTAAATAATTGGCTGAATACTGTGTAATTTCTC
CTATGATGTGTTATCGTCAAGTTGGTGCTAGCGACAATGTTGGGGAACAG
AGAAATGTTGATGTTTATAGGTGTGATTAATAAGCAGATTTGTGAGCATA
CAGAAAAATCATTTGATAGCTGAAGAATTACGGACAGAAAAGAGCGAAAC
GTAACCAGAACCGGTGACGCGTTAAATGAAACACAGATGAACAAGAAGAA
CACGCGAGCTTAATTTAGTAAACGAGAGCTGACGGTTTGGATACCGTATG
CATTGGCCCTTTTAGGTCTTCTTATCCGTCGCTCCCTTCCCACCTTTCAC
CATCATTTCCTGCTAATCCATGGATATGACCCCTGACTGGATCTTTACCC
ACTCAAGCTGCTCATCGAAGCGTTAGAAACCTCAAACGCCACAACACCCC
ACCCGACATTCCCCCGCCCCTCCTACCAAGCCGCCCAGCAACTCCCCCCA
CCCCACAACGACCCAACACCACTTATGCCTCAAACGCAACAAACCGACTA
CCGACCAAGCTCACGCCCCCCTGCCCCCCTACCTCCAAATCATACAAAAA
TACCCCTAACCACTACTCCAACAAAACCCACAGCACCAACGCCCCTCGAC
ATGCTACCCACCTCTTCCGTCAGTTAGACCGCCACAAAGTACGTAGAACA
ATACGCAACGGCATCCTACCCACCCTAAGTAGTACCGGTCGAACAAGAAN
CATTAGCCTTCCCTCTTGTACTCCCTATCGCAGCGCACTAACTCCAC
back to top