DY259746

Overview
NameDY259746
Unique NameDY259746
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length533
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
DY259746_ssr402 microsatellite DY259746_ssr402:402..413. BLAST: Citrus ESTs to Prunus persica proteins V1
DY259746_ssr41 microsatellite DY259746_ssr41:41..56. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig14780 contig Ccv1_Contig14780:2..534. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Fruit-TFcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAP10YB03FM1 Fruit-TF Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY259746 ID=DY259746|Name=DY259746|organism=Citrus clementina|type=EST|length=533bp
TTCTTGTGTTTCTGGTACTATTTGTATACTTAATATAAACTTCTTTCTTT
CTTTCTTCCTCAGAAAAATTAGAGTGAAAGAGAAGAAAGAGGTTGATTAA
AATTCATTATGGCTGGAAACAAGCAAAAAAAATCTTCTTTCTCTCTACTC
AACATGTTCAAATCGCGGAGGACTAATCGAAGATGGGAAGATCCGTGGGA
TGATGTAGGAAGCACACCGAGAAAAATTTGGCCAAGTGATGAAGATAAAG
GTGCTTACTGGGTTGCTGAGCCTGGAATTGACAGAAAAGCTTCAGCTTTT
ATTACAAAATTTCATGAAGCTCGCATCTCAGAATCCGAACGCCATGCAGT
TTATCAAGCTCTAAGGTCTTGATGACAATAACAAGCTAATTGTAGTCTCT
CTATATATATATAAGCTTAATTCTAAATTATGTTAATTTTCTTGTGTTTC
TGGTACTATTTGTTTCAAAATATATATGTTTATAAGAAGCTTGTAAAATC
ACAATAATGAATTAAAGTAGTAAGATTTGTTTG
back to top