DY259748

Overview
NameDY259748
Unique NameDY259748
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length1015
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Libraries
Library NameType
Fruit-TFcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAP10YB06FM1 Fruit-TF Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY259748 ID=DY259748|Name=DY259748|organism=Citrus clementina|type=EST|length=1015bp
CTCGCAGAACAAAAAATGATTTTCCTACTACTCCTCTCCGTTTTTCTTCG
CGGAGCTTCTTCATCAATCCTTTCCGAAGACACACCTATTAGCTTCTCAT
TTCCCTCATTCGCCAAAGACAGTTGTGACAATAAGACCCTCATTTGCTAC
GGAGCGATTGAAAGTTCCGGCGCCTTAAGCATCACACCAGGCCCTCCACC
AAACCTGCCGATCAGAAAGGTTGGACGGGTTTTATACGGCAAGCCTCTGA
GTTTACAGCGATCTTTTATTGATACCACCATCACCATTAAGATCTCACGC
CATCAGAATTACACTGATCGTGCCGGAGATGGCATGACGTTCATTTTTGC
AAGCGATAAAAACGGTCCATCAGCAAAGGGCGTCGGCGAATATCTTGGAC
TGCAGTCTTCACCAGGCGATAAATTTCCTCCATTAGCCGTGGAGCTGGAC
ACATGCCTGAACAAGAACCTGAATGATCCAGATGATAACCATATTGGCAT
CGACATAAACGGAATCGAATCAAATCCAGTTAATAGTCTGCTTGACGTTG
ATCTCAAAAGTGGACGAGCAATCCCGGTTCGAATTTATTACAATCCAGAC
TTTGGACAACTCTCTGTTTATGCGGCATATTCGGGGGAAACACTTGTGAA
GGTGGTTGAAAAACCCTTAACCTGTCAGATATAATTCCAACGCCCGTCTA
TGTTGGATTCACGCAGCTACGGGGGACTTTTTAGAAGCCCTGAAGTTATA
ATTGGACCTTCCACTCGTTCCCAGTGCCGCCCTCTCCCCAGGGAGAAAAC
CTGGTGATGCCCATATAATTCCTAACCGTCCTTGGAAACCCCGGTCCAAT
AATTTAAAATCCAATATAATTAAATTCCCCAAAAAAGGGGCCGGGCTTCT
GGCTTAAAAAATTGAAAAAAATGAATACCCCCCCAAAAGGATAAATCGGG
GTTTGCTGGCGGGCGGAAAAGGGCGTGGAGGGGGCCTTTTTAAAAAAGGC
CTCTATCTCCGCCTA
back to top