DY259752

Overview
NameDY259752
Unique NameDY259752
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length1176
Alignments
Feature NameTypeLocationAnalysis
DY259752_ssr92 microsatellite DY259752_ssr92:92..103.
Ccv1_Contig1298 contig Ccv1_Contig1298:1..1176. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
Fruit-TFcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAP10YB12FM1 Fruit-TF Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY259752 ID=DY259752|Name=DY259752|organism=Citrus clementina|type=EST|length=1176bp
CAAGTAAATTGTCAATCGATGGTGGTTCTACATAAAGTGCATCAAACATA
CCATATGTCAAGTAGCCCCAATACTTTCCTTTTTCTTTCGGTTTATTTAT
TTATTTTACGCTATATATTAGAACAGCTCAGCTGATGATATTTCATATTG
AAATATTACATTGAAAACGAGTATTTAATTAAATTTTATTTGAACATGAT
TTATTTCCAGCAATATAAATAGATGACTTCCAAATACACATAGTTAACCA
ACCACGAAACAACACTAAATAACCCCCTATGAATGACACTATTGTTCCGC
TTAGAAAAAAAGACTAATGTTGAACATGATTCCCCACACAATACACACAC
CCGTTAACGAAAAACCAACTGTAGCCGCTACCTTGCGCGGCTACGAATAT
ATTCACATGCTACCTCTATGCCCCTTACAACTACCTGAATTGTCCACACG
AACTCTATTATCTTCCTAATTCTGCTGGCCTCAAATACGAACACACCCGA
CCTCTAATACCATAAATACTCTATTCAACATTTACCCACATCTAAATAAA
ATCCCTACCACAACGACCTAAAACCACTATCCTTCCTCATTATTCATTAT
CATCTCCCACACTACCTACACCCCCCCCTCCTATCCCACACCCCTTATCC
CACACAAAACGACATAACACACAACACCCAATACAACCACAATTAAAATT
TCTACTAACCCACCAACTCAACTCACTACCTATAACATCAACTACATCCT
CACCCCATAACACCCGTCTCCTTCACCCTTCTCCCATCACATACGAATCC
CAACCAATCAACACCCACTCAGTATTCTCTATAAATTATACTCTAACGCC
AAGATACACAAAACAATATTGACTCATCACATATCACTCCCTCTTCCTGA
CAAAACAAAACCGCCCTCCTACCACAACTAAACACCACCCCCACCCGTCC
CTGCTCTCTCCGTTCCTCTATCCCACCCCCCACCCCCACTCCAACTCTAC
ACCCTCTTGACCTCCTTACAATCATACCAACTACCCCCCCTATACACCCA
CTCCCCGCGCAACTCTCTCTCACATCCACCCTATCCTCAAGTTCCCCCTT
CCCCCCCTCCCCGCCCACCAACCTCAACCTCAAGTTCACAGACACTTGAG
TCCTCCCACCCATTCACCCTTCCCAC
back to top