DY260167

Overview
NameDY260167
Unique NameDY260167
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length1062
Libraries
Library NameType
Fruit-TFcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAP11YI14FM1 Fruit-TF Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY260167 ID=DY260167|Name=DY260167|organism=Citrus clementina|type=EST|length=1062bp
CTCTTCTCCGATCCTTTTCTCGTGTCGTGTTGAGTATGTTGTTTTGTTTG
ACACTTCTTTATTTTTTTTATATCATCATCTTTTTTACTATTAATTATTT
TCTGATGGTTTGGCATTCATCTAGAAAAGATTGGTTTTTTTATTTTATAA
TTTGGGTGGGGTTTTGATTATGATGTTCATCTGTTTCAAATTTGCAGAGA
GTCATCGTAGCGTCAGTTTCGCCATGGCCAAAAGTTCATTCAAGCTCGAG
CATCCATTGGGTTCGTTAAAAATTTCAATTTTTTCTTATAAAATAAATCT
TTTCATTACTATTTTTTTATTGTTTATCCATATGCTTGTTTTGGTTAACC
CTTTGAAATATTTTTCTGGTATGATATTTTCATTGATGAGGTTTTGAGAA
ATATTTGAAATATCCGATTTTCTAATTGATTTTGTTACGAATTTGGCGAC
CTCTTGATTGATGGTGGTTCTTTGCCAATTAAAATGTCCTCAAATCTCTC
CGCCTGTATAATTCCTTCACATTGTGACCTGAAAGAATGATTTATGGTAT
CTTTTGTATATACTGCAATATGGGTAATCCCTTGGCCCCCTTTTTTTCCC
CTCCCTTAACCCCTTTCCCCAGACCAAGGAACGCACATTGTAAAAGACGG
CCCGTTGTTTGTTACCCATCTTAACCCCCTCCCACCCCCTACGCCCCTAA
CAACCAATTGCTATTCCCGAAACTTCCCACTTGGCCCGGACCCCTTCCCC
CGCTCGGCATTCGGGCGGATGTTCAAGGAAACAAACTATCATGGCTTATT
CCCGGTCCCCCACCCACTTCTCGGCCCCCTCACTTTTCTCGTCAACCCTC
TAAAACAACGATCTTACCCAAACTCACGCCCCGCCTAAACCAACAATCTT
CCACACGACGACCGCCCCCGAACAACTACAACCCCCCATCCACCCTCCTC
ACAACCTCTCCTCCGCCAAACCCCACGCATATACCCCCTCCACATACTTA
CTGTGCCCCTTCCTTCCCTATTATCTTTAATTTAATCACAACATGATTAT
TAACATAACTAT
back to top