DY260169

Overview
NameDY260169
Unique NameDY260169
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length531
Libraries
Library NameType
Fruit-TFcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAP11YI16FM1 Fruit-TF Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY260169 ID=DY260169|Name=DY260169|organism=Citrus clementina|type=EST|length=531bp
TGCCACCACTCGAACCCCCCCACCACAAAGCCCAATCAAACCGGCACCTC
TCACCCCTCCACCACCCCCGCCCCCCGCCCACAAACCCCGCGCTCCTCAC
CTTCCCACCACTACCACACTCCCCCCCTTCCAACAACACCCCACAACTGA
CCCCTGACCCCCCCCCCCCTCCCCCCCCAACCACTACACCAAAAAACATC
TCCAACACACCCTTATAGACAACCATACAAAAACAACACCAGCGAAACAT
CATTGAGACCGATACACACCCATCTAAGACCTATGGACTCTCCAAAACCT
CTCGCGCCAACCACCCCCACCTCAACCCCCACACCCACACCTCACCCTAC
ATCCCTCACTATCCCCAACCCCCTTCCCCCACTCCACCCCGTACCCCAAT
AAATAACCCCTTCCTCCCACGCCCACACCCCTCCCCTCACCCACTACCAC
CCCCCCACTCCCTCCATCACCCTCAGCCCACAACTCCTTCACCAACACAA
CATACCCCAATAATACTCACCTCAATCCTCG
back to top