DY262449

Overview
NameDY262449
Unique NameDY262449
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length1202
Libraries
Library NameType
CitNFLcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionIC0AAA100AA08RM1 CitNFL Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY262449 ID=DY262449|Name=DY262449|organism=Citrus clementina|type=EST|length=1202bp
AAAATCAAAACTCAGTGCGAAGAAGAAACCCTCGTCCTACTCAGTTACCT
AGAAAAATTCATTCAAATTCGCTATCATTCTTTCAATAATGTCACTGGGA
AGAATTCCCGGTGACCAATCGAATTCCTTTATTTAATTTATTGTTATTAT
TATTTTTTTACCCAACGCAATGAACGATTCAGATTCATTCTTCAATAAAA
CAAACAACAATAAAAGAAGTGGAGAGAATTATTTACCCTCTTCAATTTCT
TCACCACGCGGAAAATCCATAATTGTTTCAAAAACAGCAGTCGTTCGCCT
CCAGATTCTTCATCTCCCTCTGGTTTCAACCGCCACCGGTTCACCTGTCG
ACTCGCTCACGCTCGAACCGGACCGGCCTTACAGCATTGGTCGAGCCAGC
ATCAACTGTGACTTCACTTTTGATAACCGTTTGGTCAGCAGGCAACACTG
CCAGATTTTATTTGATAGTAGTGAAAGGAAAATTTATGTACTTGATGGAA
CATTTTTGTTACCTGCTTTTAGTTCTGTTGTTAATGAATTTAGAAAGAAG
AGGGATAAATCATTGGAAGATGAGGAGGAGGATGAGGGTTTTTCTAGGGT
TATGGTTTCGTTAAATGGGGTTTTTGTGAATGGGATTCGGCTTAAAAGTG
GAATTGTTAGAGAGCTGAATGCTGGTGATGAGGTTTTGTTCGTTTGTAGA
GATGAAAGTTTGTGTAGGTTACAGACTCGAATTGGGTTTTTGATTTTAGG
GATTATTTTTAAGGAGGAGGTTGTATTAAAGAGACCACGGTTAGTTGGGA
CAATGGCCTCTTTGGGACACTCCCAAGGGTCTGTGTCAAGTGCGACAAAG
GAGCAAAGGGTTTTTGCTTTAAGGGAAAATGATGTTAGCAACCCAGATTC
TGTTTTCCCAAAGTTGAAACGTTGTGATATTTTTGGGAGAGCAAGTTTTC
TCTTGAGTCAGTGTAGAAATATATTGAATAGTAACGACCCTGTGTCCTGC
ATTCGGCAGATTGCTAATTCAGATATGGGGATCATGAGTACTTTAGGGAT
GTTTTAAAACTTAGTTTCCTGGGCAGATTCTCCATTTGAGGGAAGAGTGG
AAAGTGGAAAAGAATAGAAAAAAATTTTCCCACCAGGAAACAAAAAACCT
TTGGTATGAAAAAACCCCTATTTTGGGGAGGCCGGGGCCTCAATTAATAT
TT
back to top