DY262460

Overview
NameDY262460
Unique NameDY262460
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length1298
Libraries
Library NameType
CitNFLcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
DY262460_ssr214 microsatellite DY262460_ssr214:214..225. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionIC0AAA100AB08RM1 CitNFL Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY262460 ID=DY262460|Name=DY262460|organism=Citrus clementina|type=EST|length=1298bp
CTACCTAAAGCAAGCGAGCGAGCTAAGTAGAGTCCCGCTTGCTTCATGAG
GGGAACTGGTTTTCTTTCATTGTCTTTGCTTAAGAATATTCATCTTGCTT
TTGAAGATTGTCAACCTTTTGGTTTGAACTTGATTTTTGGCTTTTGAGAA
GGTGGGTATTTTTTTTTTCTAATATGGTTGCCTGGGAGAGGTTGGGTTTT
TTGTTGCTTCTGTGGAGGAGGAGGAAATTAGGGTTCTGGGTTCATTTTGT
TTTTGGATTATGGTTTGGTTTCTTGGTTTTAAAGCCTGTGGAGGGTCTCA
GACCGTTGAGGGAGCGGGCACGGGCACGGTCCTGGGGCGATGAGTGGCTA
TTTGTTAGAAAAGATGAAAATGAATTGGGTCCGTATTCGGAATGGAACAT
AACCGGAACCTACCGAGGGACTTGGAAATTTCTGGATTCAACAAATAGCT
CTTCCAGGTTTCGAGACTTTAGAAAATCAAATGGCAATTCCATCACTGAA
TTAGTTAGCACTCCAACAAAAATAAATGGTGTGCATTATGTGCAGGGTGT
AATTATATTCCATGATGTTTTTGACAATGAGCATAATGTTGGTGGTGCTC
AAATCAGAGTTGAAGGTGTATATATATGGCCTTTTAGACAACTTCGAATG
GTAGCTCACAGCGGAAAACAGGGAGAGCTGAGCCAGGAAGATGATTATAT
TTTATCAAATCCATATCATTTGCTTGGAGTTTTCTCATCTCAGGTTTTCC
AAGAATCTCCGCGAGAGAAAATTTGGAGAAGAAAAAACTCACCAATTTAT
GAGATGGAGAAACATTGCAACATAGAAATCGCAGCCCAAATTTCCCGTGT
CTCATCGACCCAACATGAGGGTGATCATGATCGTTATCACATAGAAGGAC
TAATGGAAAGTCCTGCAGTGGATGATGATGGAGAATGCTTCTCACCTTTG
CTGCTGAATGCTACTTCTGTCAACATTGAGGTCTAATTATATAAAGCAGT
GAACTATTACCTTATTGGTTACCTTTGTTTTCTTTCCTGCGGGTCCTTTG
GTAATTCAAACAATGGAACATACAAACCTCAATCTGGGGCTGCCAAAGTT
TTCAATTTAATGAATGGGCCAAAAGCCATAAAGGGAATGCCTATTCCTTC
CCTTTTGCACTCGAACGGCGGGAAAAACTTTGTTAAACCCCTTGTTTTAA
GTGTTTTTTCAAAGGCGGTCCTTTTTTTTAAATTTTGTGAATTTCCTCCT
TATTTTTTTTATAAAGTAACAATATATCTCTTTTTGGCTTAAATATGG
back to top