FC876214

Overview
NameFC876214
Unique NameFC876214
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length725
Libraries
Library NameType
DevOvary1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Homology
BLAST of FC876214 vs. ExPASy Swiss-Prot
Match: CH60_ECOUT (60 kDa chaperonin OS=Escherichia coli (strain UTI89 / UPEC) GN=groL PE=1 SV=1)

HSP 1 Score: 243.817 bits (621), Expect = 6.940e-64
Identity = 122/216 (56.48%), Postives = 161/216 (74.54%), Query Frame = 3
Query:   75 AKDINFGVGARAAMLQGVSEVAEAVKVTMGPKGRNVIIEKSVGNPKVTKDGVTVASSIEFRDKAKDVGANLVKQVAGATNKAAGDGTTCATVLTQAILTEGCKSVAAGLNVMDLRSGIKMAIDAVISDLKSRAQMISTPEEITQVATISANGEREIGELLARAMEKVGKEGVITVVDGNTMVNELESVGGMKLARGYISPYFVTDPKTQKCELENP 722
            AKD+ FG  AR  ML+GV+ +A+AVKVT+GPKGRNV+++KS G P +TKDGV+VA  IE  DK +++GA +VK+VA   N AAGDGTT ATVL QAI+TEG K+VAAG+N MDL+ GI  A+ A + +LK+ +   S  + I QV TISAN +  +G+L+A AM+KVGKEGVITV DG  + +EL+ V GM+  RGY+SPYF+  P+T   ELE+P
Sbjct:    3 AKDVKFGNDARVKMLRGVNVLADAVKVTLGPKGRNVVLDKSFGAPTITKDGVSVAREIELEDKFENMGAQMVKEVASKANDAAGDGTTTATVLAQAIITEGLKAVAAGMNPMDLKRGIDKAVTAAVEELKALSVPCSDSKAIAQVGTISANSDETVGKLIAEAMDKVGKEGVITVEDGTGLQDELDVVEGMQFDRGYLSPYFINKPETGAVELESP 218          
BLAST of FC876214 vs. ExPASy Swiss-Prot
Match: CH60_ECOSM (60 kDa chaperonin OS=Escherichia coli (strain SMS-3-5 / SECEC) GN=groL PE=3 SV=1)

HSP 1 Score: 243.817 bits (621), Expect = 6.940e-64
Identity = 122/216 (56.48%), Postives = 161/216 (74.54%), Query Frame = 3
Query:   75 AKDINFGVGARAAMLQGVSEVAEAVKVTMGPKGRNVIIEKSVGNPKVTKDGVTVASSIEFRDKAKDVGANLVKQVAGATNKAAGDGTTCATVLTQAILTEGCKSVAAGLNVMDLRSGIKMAIDAVISDLKSRAQMISTPEEITQVATISANGEREIGELLARAMEKVGKEGVITVVDGNTMVNELESVGGMKLARGYISPYFVTDPKTQKCELENP 722
            AKD+ FG  AR  ML+GV+ +A+AVKVT+GPKGRNV+++KS G P +TKDGV+VA  IE  DK +++GA +VK+VA   N AAGDGTT ATVL QAI+TEG K+VAAG+N MDL+ GI  A+ A + +LK+ +   S  + I QV TISAN +  +G+L+A AM+KVGKEGVITV DG  + +EL+ V GM+  RGY+SPYF+  P+T   ELE+P
Sbjct:    3 AKDVKFGNDARVKMLRGVNVLADAVKVTLGPKGRNVVLDKSFGAPTITKDGVSVAREIELEDKFENMGAQMVKEVASKANDAAGDGTTTATVLAQAIITEGLKAVAAGMNPMDLKRGIDKAVTAAVEELKALSVPCSDSKAIAQVGTISANSDETVGKLIAEAMDKVGKEGVITVEDGTGLQDELDVVEGMQFDRGYLSPYFINKPETGAVELESP 218          
BLAST of FC876214 vs. ExPASy Swiss-Prot
Match: CH60_ECOSE (60 kDa chaperonin OS=Escherichia coli (strain SE11) GN=groL PE=3 SV=1)

HSP 1 Score: 243.817 bits (621), Expect = 6.940e-64
Identity = 122/216 (56.48%), Postives = 161/216 (74.54%), Query Frame = 3
Query:   75 AKDINFGVGARAAMLQGVSEVAEAVKVTMGPKGRNVIIEKSVGNPKVTKDGVTVASSIEFRDKAKDVGANLVKQVAGATNKAAGDGTTCATVLTQAILTEGCKSVAAGLNVMDLRSGIKMAIDAVISDLKSRAQMISTPEEITQVATISANGEREIGELLARAMEKVGKEGVITVVDGNTMVNELESVGGMKLARGYISPYFVTDPKTQKCELENP 722
            AKD+ FG  AR  ML+GV+ +A+AVKVT+GPKGRNV+++KS G P +TKDGV+VA  IE  DK +++GA +VK+VA   N AAGDGTT ATVL QAI+TEG K+VAAG+N MDL+ GI  A+ A + +LK+ +   S  + I QV TISAN +  +G+L+A AM+KVGKEGVITV DG  + +EL+ V GM+  RGY+SPYF+  P+T   ELE+P
Sbjct:    3 AKDVKFGNDARVKMLRGVNVLADAVKVTLGPKGRNVVLDKSFGAPTITKDGVSVAREIELEDKFENMGAQMVKEVASKANDAAGDGTTTATVLAQAIITEGLKAVAAGMNPMDLKRGIDKAVTAAVEELKALSVPCSDSKAIAQVGTISANSDETVGKLIAEAMDKVGKEGVITVEDGTGLQDELDVVEGMQFDRGYLSPYFINKPETGAVELESP 218          
BLAST of FC876214 vs. ExPASy Swiss-Prot
Match: CH60_ECOLU (60 kDa chaperonin OS=Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC) GN=groL PE=3 SV=1)

HSP 1 Score: 243.817 bits (621), Expect = 6.940e-64
Identity = 122/216 (56.48%), Postives = 161/216 (74.54%), Query Frame = 3
Query:   75 AKDINFGVGARAAMLQGVSEVAEAVKVTMGPKGRNVIIEKSVGNPKVTKDGVTVASSIEFRDKAKDVGANLVKQVAGATNKAAGDGTTCATVLTQAILTEGCKSVAAGLNVMDLRSGIKMAIDAVISDLKSRAQMISTPEEITQVATISANGEREIGELLARAMEKVGKEGVITVVDGNTMVNELESVGGMKLARGYISPYFVTDPKTQKCELENP 722
            AKD+ FG  AR  ML+GV+ +A+AVKVT+GPKGRNV+++KS G P +TKDGV+VA  IE  DK +++GA +VK+VA   N AAGDGTT ATVL QAI+TEG K+VAAG+N MDL+ GI  A+ A + +LK+ +   S  + I QV TISAN +  +G+L+A AM+KVGKEGVITV DG  + +EL+ V GM+  RGY+SPYF+  P+T   ELE+P
Sbjct:    3 AKDVKFGNDARVKMLRGVNVLADAVKVTLGPKGRNVVLDKSFGAPTITKDGVSVAREIELEDKFENMGAQMVKEVASKANDAAGDGTTTATVLAQAIITEGLKAVAAGMNPMDLKRGIDKAVTAAVEELKALSVPCSDSKAIAQVGTISANSDETVGKLIAEAMDKVGKEGVITVEDGTGLQDELDVVEGMQFDRGYLSPYFINKPETGAVELESP 218          
BLAST of FC876214 vs. ExPASy Swiss-Prot
Match: CH60_ECOLI (60 kDa chaperonin OS=Escherichia coli (strain K12) GN=groL PE=1 SV=2)

HSP 1 Score: 243.817 bits (621), Expect = 6.940e-64
Identity = 122/216 (56.48%), Postives = 161/216 (74.54%), Query Frame = 3
Query:   75 AKDINFGVGARAAMLQGVSEVAEAVKVTMGPKGRNVIIEKSVGNPKVTKDGVTVASSIEFRDKAKDVGANLVKQVAGATNKAAGDGTTCATVLTQAILTEGCKSVAAGLNVMDLRSGIKMAIDAVISDLKSRAQMISTPEEITQVATISANGEREIGELLARAMEKVGKEGVITVVDGNTMVNELESVGGMKLARGYISPYFVTDPKTQKCELENP 722
            AKD+ FG  AR  ML+GV+ +A+AVKVT+GPKGRNV+++KS G P +TKDGV+VA  IE  DK +++GA +VK+VA   N AAGDGTT ATVL QAI+TEG K+VAAG+N MDL+ GI  A+ A + +LK+ +   S  + I QV TISAN +  +G+L+A AM+KVGKEGVITV DG  + +EL+ V GM+  RGY+SPYF+  P+T   ELE+P
Sbjct:    3 AKDVKFGNDARVKMLRGVNVLADAVKVTLGPKGRNVVLDKSFGAPTITKDGVSVAREIELEDKFENMGAQMVKEVASKANDAAGDGTTTATVLAQAIITEGLKAVAAGMNPMDLKRGIDKAVTAAVEELKALSVPCSDSKAIAQVGTISANSDETVGKLIAEAMDKVGKEGVITVEDGTGLQDELDVVEGMQFDRGYLSPYFINKPETGAVELESP 218          
BLAST of FC876214 vs. ExPASy Swiss-Prot
Match: CH60_ECOLC (60 kDa chaperonin OS=Escherichia coli (strain ATCC 8739 / DSM 1576 / Crooks) GN=groL PE=3 SV=1)

HSP 1 Score: 243.817 bits (621), Expect = 6.940e-64
Identity = 122/216 (56.48%), Postives = 161/216 (74.54%), Query Frame = 3
Query:   75 AKDINFGVGARAAMLQGVSEVAEAVKVTMGPKGRNVIIEKSVGNPKVTKDGVTVASSIEFRDKAKDVGANLVKQVAGATNKAAGDGTTCATVLTQAILTEGCKSVAAGLNVMDLRSGIKMAIDAVISDLKSRAQMISTPEEITQVATISANGEREIGELLARAMEKVGKEGVITVVDGNTMVNELESVGGMKLARGYISPYFVTDPKTQKCELENP 722
            AKD+ FG  AR  ML+GV+ +A+AVKVT+GPKGRNV+++KS G P +TKDGV+VA  IE  DK +++GA +VK+VA   N AAGDGTT ATVL QAI+TEG K+VAAG+N MDL+ GI  A+ A + +LK+ +   S  + I QV TISAN +  +G+L+A AM+KVGKEGVITV DG  + +EL+ V GM+  RGY+SPYF+  P+T   ELE+P
Sbjct:    3 AKDVKFGNDARVKMLRGVNVLADAVKVTLGPKGRNVVLDKSFGAPTITKDGVSVAREIELEDKFENMGAQMVKEVASKANDAAGDGTTTATVLAQAIITEGLKAVAAGMNPMDLKRGIDKAVTAAVEELKALSVPCSDSKAIAQVGTISANSDETVGKLIAEAMDKVGKEGVITVEDGTGLQDELDVVEGMQFDRGYLSPYFINKPETGAVELESP 218          
BLAST of FC876214 vs. ExPASy Swiss-Prot
Match: CH60_ECOL6 (60 kDa chaperonin OS=Escherichia coli O6 GN=groL PE=3 SV=2)

HSP 1 Score: 243.817 bits (621), Expect = 6.940e-64
Identity = 122/216 (56.48%), Postives = 161/216 (74.54%), Query Frame = 3
Query:   75 AKDINFGVGARAAMLQGVSEVAEAVKVTMGPKGRNVIIEKSVGNPKVTKDGVTVASSIEFRDKAKDVGANLVKQVAGATNKAAGDGTTCATVLTQAILTEGCKSVAAGLNVMDLRSGIKMAIDAVISDLKSRAQMISTPEEITQVATISANGEREIGELLARAMEKVGKEGVITVVDGNTMVNELESVGGMKLARGYISPYFVTDPKTQKCELENP 722
            AKD+ FG  AR  ML+GV+ +A+AVKVT+GPKGRNV+++KS G P +TKDGV+VA  IE  DK +++GA +VK+VA   N AAGDGTT ATVL QAI+TEG K+VAAG+N MDL+ GI  A+ A + +LK+ +   S  + I QV TISAN +  +G+L+A AM+KVGKEGVITV DG  + +EL+ V GM+  RGY+SPYF+  P+T   ELE+P
Sbjct:    3 AKDVKFGNDARVKMLRGVNVLADAVKVTLGPKGRNVVLDKSFGAPTITKDGVSVAREIELEDKFENMGAQMVKEVASKANDAAGDGTTTATVLAQAIITEGLKAVAAGMNPMDLKRGIDKAVTAAVEELKALSVPCSDSKAIAQVGTISANSDETVGKLIAEAMDKVGKEGVITVEDGTGLQDELDVVEGMQFDRGYLSPYFINKPETGAVELESP 218          
BLAST of FC876214 vs. ExPASy Swiss-Prot
Match: CH60_ECOHS (60 kDa chaperonin OS=Escherichia coli O9:H4 (strain HS) GN=groL PE=3 SV=1)

HSP 1 Score: 243.817 bits (621), Expect = 6.940e-64
Identity = 122/216 (56.48%), Postives = 161/216 (74.54%), Query Frame = 3
Query:   75 AKDINFGVGARAAMLQGVSEVAEAVKVTMGPKGRNVIIEKSVGNPKVTKDGVTVASSIEFRDKAKDVGANLVKQVAGATNKAAGDGTTCATVLTQAILTEGCKSVAAGLNVMDLRSGIKMAIDAVISDLKSRAQMISTPEEITQVATISANGEREIGELLARAMEKVGKEGVITVVDGNTMVNELESVGGMKLARGYISPYFVTDPKTQKCELENP 722
            AKD+ FG  AR  ML+GV+ +A+AVKVT+GPKGRNV+++KS G P +TKDGV+VA  IE  DK +++GA +VK+VA   N AAGDGTT ATVL QAI+TEG K+VAAG+N MDL+ GI  A+ A + +LK+ +   S  + I QV TISAN +  +G+L+A AM+KVGKEGVITV DG  + +EL+ V GM+  RGY+SPYF+  P+T   ELE+P
Sbjct:    3 AKDVKFGNDARVKMLRGVNVLADAVKVTLGPKGRNVVLDKSFGAPTITKDGVSVAREIELEDKFENMGAQMVKEVASKANDAAGDGTTTATVLAQAIITEGLKAVAAGMNPMDLKRGIDKAVTAAVEELKALSVPCSDSKAIAQVGTISANSDETVGKLIAEAMDKVGKEGVITVEDGTGLQDELDVVEGMQFDRGYLSPYFINKPETGAVELESP 218          
BLAST of FC876214 vs. ExPASy Swiss-Prot
Match: CH60_ECODH (60 kDa chaperonin OS=Escherichia coli (strain K12 / DH10B) GN=groL PE=3 SV=1)

HSP 1 Score: 243.817 bits (621), Expect = 6.940e-64
Identity = 122/216 (56.48%), Postives = 161/216 (74.54%), Query Frame = 3
Query:   75 AKDINFGVGARAAMLQGVSEVAEAVKVTMGPKGRNVIIEKSVGNPKVTKDGVTVASSIEFRDKAKDVGANLVKQVAGATNKAAGDGTTCATVLTQAILTEGCKSVAAGLNVMDLRSGIKMAIDAVISDLKSRAQMISTPEEITQVATISANGEREIGELLARAMEKVGKEGVITVVDGNTMVNELESVGGMKLARGYISPYFVTDPKTQKCELENP 722
            AKD+ FG  AR  ML+GV+ +A+AVKVT+GPKGRNV+++KS G P +TKDGV+VA  IE  DK +++GA +VK+VA   N AAGDGTT ATVL QAI+TEG K+VAAG+N MDL+ GI  A+ A + +LK+ +   S  + I QV TISAN +  +G+L+A AM+KVGKEGVITV DG  + +EL+ V GM+  RGY+SPYF+  P+T   ELE+P
Sbjct:    3 AKDVKFGNDARVKMLRGVNVLADAVKVTLGPKGRNVVLDKSFGAPTITKDGVSVAREIELEDKFENMGAQMVKEVASKANDAAGDGTTTATVLAQAIITEGLKAVAAGMNPMDLKRGIDKAVTAAVEELKALSVPCSDSKAIAQVGTISANSDETVGKLIAEAMDKVGKEGVITVEDGTGLQDELDVVEGMQFDRGYLSPYFINKPETGAVELESP 218          
BLAST of FC876214 vs. ExPASy Swiss-Prot
Match: CH60_ECOBW (60 kDa chaperonin OS=Escherichia coli (strain K12 / BW2952) GN=groL PE=3 SV=1)

HSP 1 Score: 243.817 bits (621), Expect = 6.940e-64
Identity = 122/216 (56.48%), Postives = 161/216 (74.54%), Query Frame = 3
Query:   75 AKDINFGVGARAAMLQGVSEVAEAVKVTMGPKGRNVIIEKSVGNPKVTKDGVTVASSIEFRDKAKDVGANLVKQVAGATNKAAGDGTTCATVLTQAILTEGCKSVAAGLNVMDLRSGIKMAIDAVISDLKSRAQMISTPEEITQVATISANGEREIGELLARAMEKVGKEGVITVVDGNTMVNELESVGGMKLARGYISPYFVTDPKTQKCELENP 722
            AKD+ FG  AR  ML+GV+ +A+AVKVT+GPKGRNV+++KS G P +TKDGV+VA  IE  DK +++GA +VK+VA   N AAGDGTT ATVL QAI+TEG K+VAAG+N MDL+ GI  A+ A + +LK+ +   S  + I QV TISAN +  +G+L+A AM+KVGKEGVITV DG  + +EL+ V GM+  RGY+SPYF+  P+T   ELE+P
Sbjct:    3 AKDVKFGNDARVKMLRGVNVLADAVKVTLGPKGRNVVLDKSFGAPTITKDGVSVAREIELEDKFENMGAQMVKEVASKANDAAGDGTTTATVLAQAIITEGLKAVAAGMNPMDLKRGIDKAVTAAVEELKALSVPCSDSKAIAQVGTISANSDETVGKLIAEAMDKVGKEGVITVEDGTGLQDELDVVEGMQFDRGYLSPYFINKPETGAVELESP 218          
The following BLAST results are available for this feature:
BLAST of FC876214 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 500
Match NameE-valueIdentityDescription
CH60_ECOUT6.940e-6456.4860 kDa chaperonin OS=Escherichia coli (strain UTI8... [more]
CH60_ECOSM6.940e-6456.4860 kDa chaperonin OS=Escherichia coli (strain SMS-... [more]
CH60_ECOSE6.940e-6456.4860 kDa chaperonin OS=Escherichia coli (strain SE11... [more]
CH60_ECOLU6.940e-6456.4860 kDa chaperonin OS=Escherichia coli O17:K52:H18 ... [more]
CH60_ECOLI6.940e-6456.4860 kDa chaperonin OS=Escherichia coli (strain K12)... [more]
CH60_ECOLC6.940e-6456.4860 kDa chaperonin OS=Escherichia coli (strain ATCC... [more]
CH60_ECOL66.940e-6456.4860 kDa chaperonin OS=Escherichia coli O6 GN=groL P... [more]
CH60_ECOHS6.940e-6456.4860 kDa chaperonin OS=Escherichia coli O9:H4 (strai... [more]
CH60_ECODH6.940e-6456.4860 kDa chaperonin OS=Escherichia coli (strain K12 ... [more]
CH60_ECOBW6.940e-6456.4860 kDa chaperonin OS=Escherichia coli (strain K12 ... [more]

Pages

back to top
Properties
Property NameValue
Genbank descriptionC32001G09EF DevOvary1 Citrus clementina cDNA clone C32001G09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC876214 ID=FC876214|Name=FC876214|organism=Citrus clementina|type=EST|length=725bp
GAGCCTCTTCAATCAGTTCCCCTCGCTGCAAGAAAGGGGTGTATGGTAGG
GTTTTATGCAATAGGAACTATGTGGCGAAGGATATCAATTTTGGAGTTGG
TGCACGAGCTGCCATGTTACAAGGTGTATCCGAGGTGGCAGAAGCTGTAA
AAGTTACCATGGGACCAAAGGGTCGCAATGTGATTATTGAGAAAAGTGTT
GGAAATCCCAAGGTCACAAAGGATGGTGTTACTGTTGCCAGCAGCATAGA
ATTCAGGGACAAGGCAAAAGATGTTGGTGCAAACCTTGTAAAGCAGGTTG
CCGGTGCTACTAATAAAGCTGCGGGAGATGGTACAACTTGCGCAACTGTT
CTGACTCAGGCCATTCTCACAGAAGGCTGTAAATCTGTAGCTGCTGGTCT
AAATGTGATGGATTTGCGCAGTGGTATTAAGATGGCGATCGATGCAGTCA
TATCTGATTTAAAAAGCAGAGCACAAATGATTAGTACACCGGAAGAAATT
ACACAGGTGGCGACTATCTCTGCAAATGGTGAACGGGAGATTGGGGAACT
GCTAGCAAGAGCAATGGAGAAAGTTGGAAAGGAAGGAGTCATTACTGTTG
TTGATGGAAATACTATGGTTAATGAGCTGGAAAGTGTTGGAGGAATGAAG
CTAGCCAGAGGTTACATTTCTCCTTATTTTGTTACAGATCCAAAGACACA
GAAATGTGAACTTGAAAATCCTCTG
back to top