FC876214

Overview
NameFC876214
Unique NameFC876214
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length725
Libraries
Library NameType
DevOvary1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Homology
BLAST of FC876214 vs. ExPASy Swiss-Prot
Match: CH60_SALHS (60 kDa chaperonin OS=Salmonella heidelberg (strain SL476) GN=groL PE=3 SV=1)

HSP 1 Score: 242.276 bits (617), Expect = 2.019e-63
Identity = 121/216 (56.02%), Postives = 161/216 (74.54%), Query Frame = 3
Query:   75 AKDINFGVGARAAMLQGVSEVAEAVKVTMGPKGRNVIIEKSVGNPKVTKDGVTVASSIEFRDKAKDVGANLVKQVAGATNKAAGDGTTCATVLTQAILTEGCKSVAAGLNVMDLRSGIKMAIDAVISDLKSRAQMISTPEEITQVATISANGEREIGELLARAMEKVGKEGVITVVDGNTMVNELESVGGMKLARGYISPYFVTDPKTQKCELENP 722
            AKD+ FG  AR  ML+GV+ +A+AVKVT+GPKGRNV+++KS G P +TKDGV+VA  IE  DK +++GA +VK+VA   N AAGDGTT ATVL Q+I+TEG K+VAAG+N MDL+ GI  A+ A + +LK+ +   S  + I QV TISAN +  +G+L+A AM+KVGKEGVITV DG  + +EL+ V GM+  RGY+SPYF+  P+T   ELE+P
Sbjct:    3 AKDVKFGNDARVKMLRGVNVLADAVKVTLGPKGRNVVLDKSFGAPTITKDGVSVAREIELEDKFENMGAQMVKEVASKANDAAGDGTTTATVLAQSIITEGLKAVAAGMNPMDLKRGIDKAVAAAVEELKALSVPCSDSKAIAQVGTISANSDETVGKLIAEAMDKVGKEGVITVEDGTGLQDELDVVEGMQFDRGYLSPYFINKPETGAVELESP 218          
BLAST of FC876214 vs. ExPASy Swiss-Prot
Match: CH60_SALG2 (60 kDa chaperonin OS=Salmonella gallinarum (strain 287/91 / NCTC 13346) GN=groL PE=3 SV=1)

HSP 1 Score: 242.276 bits (617), Expect = 2.019e-63
Identity = 121/216 (56.02%), Postives = 161/216 (74.54%), Query Frame = 3
Query:   75 AKDINFGVGARAAMLQGVSEVAEAVKVTMGPKGRNVIIEKSVGNPKVTKDGVTVASSIEFRDKAKDVGANLVKQVAGATNKAAGDGTTCATVLTQAILTEGCKSVAAGLNVMDLRSGIKMAIDAVISDLKSRAQMISTPEEITQVATISANGEREIGELLARAMEKVGKEGVITVVDGNTMVNELESVGGMKLARGYISPYFVTDPKTQKCELENP 722
            AKD+ FG  AR  ML+GV+ +A+AVKVT+GPKGRNV+++KS G P +TKDGV+VA  IE  DK +++GA +VK+VA   N AAGDGTT ATVL Q+I+TEG K+VAAG+N MDL+ GI  A+ A + +LK+ +   S  + I QV TISAN +  +G+L+A AM+KVGKEGVITV DG  + +EL+ V GM+  RGY+SPYF+  P+T   ELE+P
Sbjct:    3 AKDVKFGNDARVKMLRGVNVLADAVKVTLGPKGRNVVLDKSFGAPTITKDGVSVAREIELEDKFENMGAQMVKEVASKANDAAGDGTTTATVLAQSIITEGLKAVAAGMNPMDLKRGIDKAVAAAVEELKALSVPCSDSKAIAQVGTISANSDETVGKLIAEAMDKVGKEGVITVEDGTGLQDELDVVEGMQFDRGYLSPYFINKPETGAVELESP 218          
BLAST of FC876214 vs. ExPASy Swiss-Prot
Match: CH60_SALEP (60 kDa chaperonin OS=Salmonella enteritidis PT4 (strain P125109) GN=groL PE=3 SV=1)

HSP 1 Score: 242.276 bits (617), Expect = 2.019e-63
Identity = 121/216 (56.02%), Postives = 161/216 (74.54%), Query Frame = 3
Query:   75 AKDINFGVGARAAMLQGVSEVAEAVKVTMGPKGRNVIIEKSVGNPKVTKDGVTVASSIEFRDKAKDVGANLVKQVAGATNKAAGDGTTCATVLTQAILTEGCKSVAAGLNVMDLRSGIKMAIDAVISDLKSRAQMISTPEEITQVATISANGEREIGELLARAMEKVGKEGVITVVDGNTMVNELESVGGMKLARGYISPYFVTDPKTQKCELENP 722
            AKD+ FG  AR  ML+GV+ +A+AVKVT+GPKGRNV+++KS G P +TKDGV+VA  IE  DK +++GA +VK+VA   N AAGDGTT ATVL Q+I+TEG K+VAAG+N MDL+ GI  A+ A + +LK+ +   S  + I QV TISAN +  +G+L+A AM+KVGKEGVITV DG  + +EL+ V GM+  RGY+SPYF+  P+T   ELE+P
Sbjct:    3 AKDVKFGNDARVKMLRGVNVLADAVKVTLGPKGRNVVLDKSFGAPTITKDGVSVAREIELEDKFENMGAQMVKEVASKANDAAGDGTTTATVLAQSIITEGLKAVAAGMNPMDLKRGIDKAVAAAVEELKALSVPCSDSKAIAQVGTISANSDETVGKLIAEAMDKVGKEGVITVEDGTGLQDELDVVEGMQFDRGYLSPYFINKPETGAVELESP 218          
BLAST of FC876214 vs. ExPASy Swiss-Prot
Match: CH60_SALDC (60 kDa chaperonin OS=Salmonella dublin (strain CT_02021853) GN=groL PE=3 SV=1)

HSP 1 Score: 242.276 bits (617), Expect = 2.019e-63
Identity = 121/216 (56.02%), Postives = 161/216 (74.54%), Query Frame = 3
Query:   75 AKDINFGVGARAAMLQGVSEVAEAVKVTMGPKGRNVIIEKSVGNPKVTKDGVTVASSIEFRDKAKDVGANLVKQVAGATNKAAGDGTTCATVLTQAILTEGCKSVAAGLNVMDLRSGIKMAIDAVISDLKSRAQMISTPEEITQVATISANGEREIGELLARAMEKVGKEGVITVVDGNTMVNELESVGGMKLARGYISPYFVTDPKTQKCELENP 722
            AKD+ FG  AR  ML+GV+ +A+AVKVT+GPKGRNV+++KS G P +TKDGV+VA  IE  DK +++GA +VK+VA   N AAGDGTT ATVL Q+I+TEG K+VAAG+N MDL+ GI  A+ A + +LK+ +   S  + I QV TISAN +  +G+L+A AM+KVGKEGVITV DG  + +EL+ V GM+  RGY+SPYF+  P+T   ELE+P
Sbjct:    3 AKDVKFGNDARVKMLRGVNVLADAVKVTLGPKGRNVVLDKSFGAPTITKDGVSVAREIELEDKFENMGAQMVKEVASKANDAAGDGTTTATVLAQSIITEGLKAVAAGMNPMDLKRGIDKAVAAAVEELKALSVPCSDSKAIAQVGTISANSDETVGKLIAEAMDKVGKEGVITVEDGTGLQDELDVVEGMQFDRGYLSPYFINKPETGAVELESP 218          
BLAST of FC876214 vs. ExPASy Swiss-Prot
Match: CH60_SALCH (60 kDa chaperonin OS=Salmonella choleraesuis GN=groL PE=3 SV=1)

HSP 1 Score: 242.276 bits (617), Expect = 2.019e-63
Identity = 121/216 (56.02%), Postives = 161/216 (74.54%), Query Frame = 3
Query:   75 AKDINFGVGARAAMLQGVSEVAEAVKVTMGPKGRNVIIEKSVGNPKVTKDGVTVASSIEFRDKAKDVGANLVKQVAGATNKAAGDGTTCATVLTQAILTEGCKSVAAGLNVMDLRSGIKMAIDAVISDLKSRAQMISTPEEITQVATISANGEREIGELLARAMEKVGKEGVITVVDGNTMVNELESVGGMKLARGYISPYFVTDPKTQKCELENP 722
            AKD+ FG  AR  ML+GV+ +A+AVKVT+GPKGRNV+++KS G P +TKDGV+VA  IE  DK +++GA +VK+VA   N AAGDGTT ATVL Q+I+TEG K+VAAG+N MDL+ GI  A+ A + +LK+ +   S  + I QV TISAN +  +G+L+A AM+KVGKEGVITV DG  + +EL+ V GM+  RGY+SPYF+  P+T   ELE+P
Sbjct:    3 AKDVKFGNDARVKMLRGVNVLADAVKVTLGPKGRNVVLDKSFGAPTITKDGVSVAREIELEDKFENMGAQMVKEVASKANDAAGDGTTTATVLAQSIITEGLKAVAAGMNPMDLKRGIDKAVAAAVEELKALSVPCSDSKAIAQVGTISANSDETVGKLIAEAMDKVGKEGVITVEDGTGLQDELDVVEGMQFDRGYLSPYFINKPETGAVELESP 218          
BLAST of FC876214 vs. ExPASy Swiss-Prot
Match: CH60_SALA4 (60 kDa chaperonin OS=Salmonella agona (strain SL483) GN=groL PE=3 SV=1)

HSP 1 Score: 242.276 bits (617), Expect = 2.019e-63
Identity = 121/216 (56.02%), Postives = 161/216 (74.54%), Query Frame = 3
Query:   75 AKDINFGVGARAAMLQGVSEVAEAVKVTMGPKGRNVIIEKSVGNPKVTKDGVTVASSIEFRDKAKDVGANLVKQVAGATNKAAGDGTTCATVLTQAILTEGCKSVAAGLNVMDLRSGIKMAIDAVISDLKSRAQMISTPEEITQVATISANGEREIGELLARAMEKVGKEGVITVVDGNTMVNELESVGGMKLARGYISPYFVTDPKTQKCELENP 722
            AKD+ FG  AR  ML+GV+ +A+AVKVT+GPKGRNV+++KS G P +TKDGV+VA  IE  DK +++GA +VK+VA   N AAGDGTT ATVL Q+I+TEG K+VAAG+N MDL+ GI  A+ A + +LK+ +   S  + I QV TISAN +  +G+L+A AM+KVGKEGVITV DG  + +EL+ V GM+  RGY+SPYF+  P+T   ELE+P
Sbjct:    3 AKDVKFGNDARVKMLRGVNVLADAVKVTLGPKGRNVVLDKSFGAPTITKDGVSVAREIELEDKFENMGAQMVKEVASKANDAAGDGTTTATVLAQSIITEGLKAVAAGMNPMDLKRGIDKAVAAAVEELKALSVPCSDSKAIAQVGTISANSDETVGKLIAEAMDKVGKEGVITVEDGTGLQDELDVVEGMQFDRGYLSPYFINKPETGAVELESP 218          
BLAST of FC876214 vs. ExPASy Swiss-Prot
Match: CH60_KLEPL (60 kDa chaperonin (Fragment) OS=Klebsiella planticola GN=groL PE=3 SV=1)

HSP 1 Score: 242.276 bits (617), Expect = 2.019e-63
Identity = 121/216 (56.02%), Postives = 161/216 (74.54%), Query Frame = 3
Query:   75 AKDINFGVGARAAMLQGVSEVAEAVKVTMGPKGRNVIIEKSVGNPKVTKDGVTVASSIEFRDKAKDVGANLVKQVAGATNKAAGDGTTCATVLTQAILTEGCKSVAAGLNVMDLRSGIKMAIDAVISDLKSRAQMISTPEEITQVATISANGEREIGELLARAMEKVGKEGVITVVDGNTMVNELESVGGMKLARGYISPYFVTDPKTQKCELENP 722
            AKD+ FG  AR  ML+GV+ +A+AVKVT+GPKGRNV+++KS G P +TKDGV+VA  IE  DK +++GA +VK+VA   N AAGDGTT ATVL Q+I+TEG K+VAAG+N MDL+ GI  A+ A + +LK+ +   S  + I QV TISAN +  +G+L+A AM+KVGKEGVITV DG  + +EL+ V GM+  RGY+SPYF+  P+T   ELE+P
Sbjct:    3 AKDVKFGNDARVKMLRGVNVLADAVKVTLGPKGRNVVLDKSFGAPTITKDGVSVAREIELEDKFENMGAQMVKEVASKANDAAGDGTTTATVLAQSIITEGLKAVAAGMNPMDLKRGIDKAVAAAVEELKTLSVPCSDSKAIAQVGTISANSDETVGKLIAEAMDKVGKEGVITVEDGTGLQDELDVVEGMQFDRGYLSPYFINKPETGAVELESP 218          
BLAST of FC876214 vs. ExPASy Swiss-Prot
Match: CH60_ESCF3 (60 kDa chaperonin OS=Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CDC 0568-73) GN=groL PE=3 SV=1)

HSP 1 Score: 242.276 bits (617), Expect = 2.019e-63
Identity = 121/216 (56.02%), Postives = 160/216 (74.07%), Query Frame = 3
Query:   75 AKDINFGVGARAAMLQGVSEVAEAVKVTMGPKGRNVIIEKSVGNPKVTKDGVTVASSIEFRDKAKDVGANLVKQVAGATNKAAGDGTTCATVLTQAILTEGCKSVAAGLNVMDLRSGIKMAIDAVISDLKSRAQMISTPEEITQVATISANGEREIGELLARAMEKVGKEGVITVVDGNTMVNELESVGGMKLARGYISPYFVTDPKTQKCELENP 722
            AKD+ FG  AR  ML+GV+ +A+AVKVT+GPKGRNV+++KS G P +TKDGV+VA  IE  DK +++GA +VK+VA   N  AGDGTT ATVL QAI+TEG K+VAAG+N MDL+ GI  A+ A + +LK+ +   S  + I QV TISAN +  +G+L+A AM+KVGKEGVITV DG  + +EL+ V GM+  RGY+SPYF+  P+T   ELE+P
Sbjct:    3 AKDVKFGNDARVKMLRGVNVLADAVKVTLGPKGRNVVLDKSFGAPTITKDGVSVAREIELEDKFENMGAQMVKEVASKANDTAGDGTTTATVLAQAIITEGLKAVAAGMNPMDLKRGIDKAVTAAVEELKALSVPCSDSKAIAQVGTISANSDETVGKLIAEAMDKVGKEGVITVEDGTGLQDELDVVEGMQFDRGYLSPYFINKPETGAVELESP 218          
BLAST of FC876214 vs. ExPASy Swiss-Prot
Match: CH60_ENTAG (60 kDa chaperonin (Fragment) OS=Enterobacter agglomerans GN=groL PE=3 SV=1)

HSP 1 Score: 242.276 bits (617), Expect = 2.019e-63
Identity = 121/216 (56.02%), Postives = 161/216 (74.54%), Query Frame = 3
Query:   75 AKDINFGVGARAAMLQGVSEVAEAVKVTMGPKGRNVIIEKSVGNPKVTKDGVTVASSIEFRDKAKDVGANLVKQVAGATNKAAGDGTTCATVLTQAILTEGCKSVAAGLNVMDLRSGIKMAIDAVISDLKSRAQMISTPEEITQVATISANGEREIGELLARAMEKVGKEGVITVVDGNTMVNELESVGGMKLARGYISPYFVTDPKTQKCELENP 722
            AKD+ FG  AR  ML+GV+ +A+AVKVT+GPKGRNV+++KS G P +TKDGV+VA  IE  DK +++GA +VK+VA   N AAGDGTT ATVL QAI+TEG K+VAAG+N MDL+ GI  A+ + + +LK+ +   S  + I QV TISAN +  +G+L+A AM+KVGKEGVITV DG  + +EL+ V GM+  RGY+SPYF+  P+T   ELE+P
Sbjct:    3 AKDVKFGNDARVKMLRGVNVLADAVKVTLGPKGRNVVLDKSFGAPTITKDGVSVAREIELEDKFENMGAQMVKEVASKANDAAGDGTTTATVLAQAIITEGLKAVAAGMNPMDLKRGIDKAVASAVEELKALSVPCSDSKAIAQVGTISANSDETVGKLIAEAMDKVGKEGVITVEDGTGLEDELDVVEGMQFDRGYLSPYFINKPETGAVELESP 218          
BLAST of FC876214 vs. ExPASy Swiss-Prot
Match: CH60_EDWI9 (60 kDa chaperonin OS=Edwardsiella ictaluri (strain 93-146) GN=groL PE=3 SV=1)

HSP 1 Score: 242.276 bits (617), Expect = 2.019e-63
Identity = 121/216 (56.02%), Postives = 161/216 (74.54%), Query Frame = 3
Query:   75 AKDINFGVGARAAMLQGVSEVAEAVKVTMGPKGRNVIIEKSVGNPKVTKDGVTVASSIEFRDKAKDVGANLVKQVAGATNKAAGDGTTCATVLTQAILTEGCKSVAAGLNVMDLRSGIKMAIDAVISDLKSRAQMISTPEEITQVATISANGEREIGELLARAMEKVGKEGVITVVDGNTMVNELESVGGMKLARGYISPYFVTDPKTQKCELENP 722
            AKD+ FG  AR  ML+GV+ +A+AVKVT+GPKGRNV+++KS G+P +TKDGV+VA  IE  DK +++GA +VK+VA   N AAGDGTT ATVL QAI+ EG K+VAAG+N MDL+ GI  A+ A + +LK+ +   S  + I QV TISAN +  +G+L+A AMEKVGKEGVITV +G  + +EL+ V GM+  RGY+SPYF+  P+T   ELE+P
Sbjct:    3 AKDVKFGNDARVKMLRGVNVLADAVKVTLGPKGRNVVLDKSFGSPAITKDGVSVAREIELEDKFENMGAQMVKEVASKANDAAGDGTTTATVLAQAIVNEGLKAVAAGMNPMDLKRGIDKAVSAAVEELKALSVPCSDSKAIAQVGTISANADDTVGQLIAEAMEKVGKEGVITVEEGTGLQDELDVVEGMQFDRGYLSPYFINKPETGAVELESP 218          
The following BLAST results are available for this feature:
BLAST of FC876214 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 500
Match NameE-valueIdentityDescription
CH60_SALHS2.019e-6356.0260 kDa chaperonin OS=Salmonella heidelberg (strain... [more]
CH60_SALG22.019e-6356.0260 kDa chaperonin OS=Salmonella gallinarum (strain... [more]
CH60_SALEP2.019e-6356.0260 kDa chaperonin OS=Salmonella enteritidis PT4 (s... [more]
CH60_SALDC2.019e-6356.0260 kDa chaperonin OS=Salmonella dublin (strain CT_... [more]
CH60_SALCH2.019e-6356.0260 kDa chaperonin OS=Salmonella choleraesuis GN=gr... [more]
CH60_SALA42.019e-6356.0260 kDa chaperonin OS=Salmonella agona (strain SL48... [more]
CH60_KLEPL2.019e-6356.0260 kDa chaperonin (Fragment) OS=Klebsiella plantic... [more]
CH60_ESCF32.019e-6356.0260 kDa chaperonin OS=Escherichia fergusonii (strai... [more]
CH60_ENTAG2.019e-6356.0260 kDa chaperonin (Fragment) OS=Enterobacter agglo... [more]
CH60_EDWI92.019e-6356.0260 kDa chaperonin OS=Edwardsiella ictaluri (strain... [more]

Pages

back to top
Properties
Property NameValue
Genbank descriptionC32001G09EF DevOvary1 Citrus clementina cDNA clone C32001G09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC876214 ID=FC876214|Name=FC876214|organism=Citrus clementina|type=EST|length=725bp
GAGCCTCTTCAATCAGTTCCCCTCGCTGCAAGAAAGGGGTGTATGGTAGG
GTTTTATGCAATAGGAACTATGTGGCGAAGGATATCAATTTTGGAGTTGG
TGCACGAGCTGCCATGTTACAAGGTGTATCCGAGGTGGCAGAAGCTGTAA
AAGTTACCATGGGACCAAAGGGTCGCAATGTGATTATTGAGAAAAGTGTT
GGAAATCCCAAGGTCACAAAGGATGGTGTTACTGTTGCCAGCAGCATAGA
ATTCAGGGACAAGGCAAAAGATGTTGGTGCAAACCTTGTAAAGCAGGTTG
CCGGTGCTACTAATAAAGCTGCGGGAGATGGTACAACTTGCGCAACTGTT
CTGACTCAGGCCATTCTCACAGAAGGCTGTAAATCTGTAGCTGCTGGTCT
AAATGTGATGGATTTGCGCAGTGGTATTAAGATGGCGATCGATGCAGTCA
TATCTGATTTAAAAAGCAGAGCACAAATGATTAGTACACCGGAAGAAATT
ACACAGGTGGCGACTATCTCTGCAAATGGTGAACGGGAGATTGGGGAACT
GCTAGCAAGAGCAATGGAGAAAGTTGGAAAGGAAGGAGTCATTACTGTTG
TTGATGGAAATACTATGGTTAATGAGCTGGAAAGTGTTGGAGGAATGAAG
CTAGCCAGAGGTTACATTTCTCCTTATTTTGTTACAGATCCAAAGACACA
GAAATGTGAACTTGAAAATCCTCTG
back to top