DC900195

Overview
NameDC900195
Unique NameDC900195
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length770
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2169 contig Csv1_Contig2169:218..987. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of DC900195 vs. ExPASy Swiss-Prot
Match: EFTU_LEUCK (Elongation factor Tu OS=Leuconostoc citreum (strain KM20) GN=tuf PE=3 SV=1)

HSP 1 Score: 119.783 bits (299), Expect = 1.690e-26
Identity = 77/215 (35.81%), Postives = 115/215 (53.49%), Query Frame = 1
Query:   61 LDKLKAERERGITIDIALWKFETTKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIVKEVSSYLKKVGYNPEKVPFV---PISGFEGD----NMIERSTNLDWYKGPTLLDALDN-INEPKRPSDKPLRLPLQDVYKIGGIGTVPVGRVETGVLKPGMXV 681
            +D    E+ERGITI+ +  ++ET   +   IDAPGH D++KNMITG +Q D A+L++ +T G          QTREH LLA  +GV+ ++   NK D       +   + +  EV   L +  +  + +P +    +   EGD     +IE            L+D +D+ I EPKR +DKP  +P++DV+ I G GTV  GRV+ GVL  G  +
Sbjct:   50 IDNAPEEKERGITINTSHIEYETETRHYAHIDAPGHADYVKNMITGAAQMDGAILVVAATDGPMP-------QTREHILLARQVGVEYLVVFLNKTDLVD---DEELVELVEMEVRELLSEYDFPGDDIPVIKGSALKALEGDPEQVKVIEE-----------LMDTVDSYIPEPKRETDKPFLMPVEDVFTITGRGTVASGRVDRGVLTTGTEI 243          
BLAST of DC900195 vs. ExPASy Swiss-Prot
Match: EFTU_GEOUR (Elongation factor Tu OS=Geobacter uraniireducens (strain Rf4) GN=tuf1 PE=3 SV=1)

HSP 1 Score: 119.783 bits (299), Expect = 1.690e-26
Identity = 79/227 (34.80%), Postives = 115/227 (50.66%), Query Frame = 1
Query:   13 KEAAEMNKRSFKYAWVLDKLKAERERGITIDIALWKFETTKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIVKEVSSYLKKVGYNPEKVPFV---PISGFEGDNMIERSTNLDWYKGPTLLDALDN-INEPKRPSDKPLRLPLQDVYKIGGIGTVPVGRVETGVLKPGMXV 681
            K  A   +  FK    +D    ERERGITI  A  ++ET K +   +D PGH D++KNMITG +Q D A+L++ +  G          QTREH LLA  +GV  ++   NK D       +   + +  E+   L    +  + +P +    +   EGD     +  L       L++A+D+ I EP R  DKP  +P++DV+ I G GTV  GRVE G++K G  V
Sbjct:   34 KVLAGKGQAEFKAFDQIDNAPEERERGITIATAHVEYETDKRHYAHVDCPGHADYVKNMITGAAQMDGAILVVSAADGPMP-------QTREHILLARQVGVPYIVVFLNKADMVD---DEELLELVELEIRELLSSYDFPGDDIPIIKGSALKALEGD-----TGELGEQAIMKLMEAVDSYIPEPVRAIDKPFLMPVEDVFSISGRGTVATGRVERGIVKVGEEV 245          
BLAST of DC900195 vs. ExPASy Swiss-Prot
Match: EFTU_CHLL2 (Elongation factor Tu OS=Chlorobium limicola (strain DSM 245 / NBRC 103803) GN=tuf PE=3 SV=1)

HSP 1 Score: 119.783 bits (299), Expect = 1.690e-26
Identity = 75/206 (36.41%), Postives = 110/206 (53.40%), Query Frame = 1
Query:   61 LDKLKAERERGITIDIALWKFETTKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIVKEVSSYLKKVGYNPEKVPFV---PISGFEGDNMIERSTNLDWYKGPTLLDALDN-INEPKRPSDKPLRLPLQDVYKIGGIGTVPVGRVETGVLK 666
            +DK   ERERGITI  A  +++T K +   ID PGH D+IKNMITG +Q D A+L++  T G          QTREH LLA  + V  ++   NK+D   P+      + +  E+   L +  +  + +P +    +   +GD   E++          L+DA+D  I EP R  DKP  +P++DV+ I G GTV  GR+E G +K
Sbjct:   50 IDKAPEERERGITISTAHVEYQTKKRHYAHIDCPGHADYIKNMITGAAQMDGAILVVAGTDGPMP-------QTREHILLARQVNVPALVVFLNKVDIADPEL----LELVELELRELLTEYNFPGDDIPIIKGSALKALDGDPEGEKAI-------MELMDAVDEFIPEPVRDVDKPFLMPVEDVFSISGRGTVGTGRIERGRIK 237          
BLAST of DC900195 vs. ExPASy Swiss-Prot
Match: CYSN_METPB (Sulfate adenylyltransferase subunit 1 OS=Methylobacterium populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001) GN=cysN PE=3 SV=1)

HSP 1 Score: 119.783 bits (299), Expect = 1.690e-26
Identity = 75/222 (33.78%), Postives = 115/222 (51.80%), Query Frame = 1
Query:   52 AWVLDKLKAERERGITIDIALWKFETTKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIVKEVSSYLKKVGYNPEKVPFVPISGFEGDNMIERSTNLDWYKGPTLLDALDNINEPKRPSDKPLRLPLQDVYKIGGIGTVPVGRVETGVLKPGMXVTFGPSGLTTEVS 717
            A ++D L+AERE+GITID+A   F T +    V D PGH  + +NM TG S AD AV+++D+  G          QTR HALL   LG+ ++    NKMD     +S+ ++D I+    ++   + ++  +V  +P+S   GDN++   T   WY G  LL  L+ +           R+P+Q V +         G + +G + PG  VT  PSG T+ V+
Sbjct:   76 ALLVDGLQAEREQGITIDVAYRFFSTDRRSFIVADTPGHEQYTRNMATGASTADVAVILVDARHG-------LTRQTRRHALLVSLLGIHRVALAINKMDLV--GWSQDKFDAILSGFQAFAAPLNFS--EVRAIPLSAKNGDNVVLPGTAATWYDGVPLLRYLEEVPVKSEERAAAFRMPVQWVNRPNSDFRGFSGLIASGSVAPGDAVTVAPSGKTSTVA 286          
BLAST of DC900195 vs. ExPASy Swiss-Prot
Match: CYSN_FRATT (Sulfate adenylyltransferase subunit 1 OS=Francisella tularensis subsp. tularensis GN=cysN PE=3 SV=1)

HSP 1 Score: 119.783 bits (299), Expect = 1.690e-26
Identity = 82/226 (36.28%), Postives = 117/226 (51.77%), Query Frame = 1
Query:   52 AWVLDKLKAERERGITIDIALWKFETTKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIVKEVSSYLKKVG-YNPEKVPFVPISGFEGDNMIERSTNLDWYKGPTLLDALDNINEPKRPSDKPLRLPLQDVYKIGGIGTVPVGRVETGVLKPGMXVTFGPSG-LTTEVSLL 723
            A ++D L++ERE+GITID+A   F T K    + D PGH  + +NM TG S  D A+++ID+  G          QTR H  +   LG+K +I   NKMD  T  YS+  Y  I  E   YLK  G      + FVPIS  +GDN++ +S  + W++G  L+  L+ I      +D+  R P+Q V +         G V +G  K G  +   PSG +TT  S+L
Sbjct:   76 ALLVDGLQSEREQGITIDVAYRYFSTDKRKFIIADTPGHEQYTRNMATGASNCDLAIILIDARKG-------LQTQTRRHNFICSLLGIKHVIVAVNKMD--TVGYSQQIYKSIQDE---YLKLAGSLQIPDIRFVPISALDGDNVVSKSPKMPWFRGSPLMHYLETIKIDYAYTDE-FRFPVQLVCRPNSEFRGFQGTVVSGSAKIGDTIRVMPSGKITTIKSIL 288          
BLAST of DC900195 vs. ExPASy Swiss-Prot
Match: CYSN_FRAT1 (Sulfate adenylyltransferase subunit 1 OS=Francisella tularensis subsp. tularensis (strain FSC 198) GN=cysN PE=3 SV=1)

HSP 1 Score: 119.783 bits (299), Expect = 1.690e-26
Identity = 82/226 (36.28%), Postives = 117/226 (51.77%), Query Frame = 1
Query:   52 AWVLDKLKAERERGITIDIALWKFETTKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIVKEVSSYLKKVG-YNPEKVPFVPISGFEGDNMIERSTNLDWYKGPTLLDALDNINEPKRPSDKPLRLPLQDVYKIGGIGTVPVGRVETGVLKPGMXVTFGPSG-LTTEVSLL 723
            A ++D L++ERE+GITID+A   F T K    + D PGH  + +NM TG S  D A+++ID+  G          QTR H  +   LG+K +I   NKMD  T  YS+  Y  I  E   YLK  G      + FVPIS  +GDN++ +S  + W++G  L+  L+ I      +D+  R P+Q V +         G V +G  K G  +   PSG +TT  S+L
Sbjct:   76 ALLVDGLQSEREQGITIDVAYRYFSTDKRKFIIADTPGHEQYTRNMATGASNCDLAIILIDARKG-------LQTQTRRHNFICSLLGIKHVIVAVNKMD--TVGYSQQIYKSIQDE---YLKLAGSLQIPDIRFVPISALDGDNVVSKSPKMPWFRGSPLMHYLETIKIDYAYTDE-FRFPVQLVCRPNSEFRGFQGTVVSGSAKIGDTIRVMPSGKITTIKSIL 288          
BLAST of DC900195 vs. ExPASy Swiss-Prot
Match: EFTU_SYNFM (Elongation factor Tu OS=Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB) GN=tuf1 PE=3 SV=1)

HSP 1 Score: 119.398 bits (298), Expect = 2.207e-26
Identity = 79/223 (35.43%), Postives = 118/223 (52.91%), Query Frame = 1
Query:   13 KEAAEMNKRSFKYAWVLDKLKAERERGITIDIALWKFETTKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIVK-EVSSYLKKVGYNPEKVPFV---PISGFEGDNMIERSTNLDWYKGPTLLDALD-NINEPKRPSDKPLRLPLQDVYKIGGIGTVPVGRVETGVLK 666
            K+ A+  +  F     +DK   ERERGITI  A  ++ET K +   +D PGH D+IKNMITG +Q D A+L++ +  G          QTREH LL+  +GV  ++   NK+D            E+V+ E+   L K G+  + VP +    +   E D+     T   +     L++A+D  + +P R  DKP  +P++DV+ I G GTV  GRVE GV++
Sbjct:   34 KQLAKRGRAEFVPFDQIDKAPEERERGITIATAHVEYETDKRHYAHVDCPGHADYIKNMITGAAQMDGAILVVAADDGPMP-------QTREHILLSRQVGVPYIVVFLNKVDMV----DDPELIELVELELRELLSKYGFPGDDVPIIKGSALRALEADDPEHPDTKCIF----ELMEAIDAYVPDPVRDIDKPFLMPIEDVFSISGRGTVVTGRVERGVIR 241          
BLAST of DC900195 vs. ExPASy Swiss-Prot
Match: EFTU_SALAI (Elongation factor Tu OS=Salinispora arenicola (strain CNS-205) GN=tuf PE=3 SV=1)

HSP 1 Score: 119.398 bits (298), Expect = 2.207e-26
Identity = 78/212 (36.79%), Postives = 113/212 (53.30%), Query Frame = 1
Query:   61 LDKLKAERERGITIDIALWKFETTKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIVKEVSSYLKKVGYNPEKVPFVPIS---GFEGDNMIERSTNLDWY-KGPTLLDALD-NINEPKRPSDKPLRLPLQDVYKIGGIGTVPVGRVETGVLKPGMXV 681
            +DK   E+ RGITI IA  +++T   +   +D PGH D+IKNMITG +Q D A+L++ +T G          QTREH LLA  +GV  ++   NK D       +   + +  EV   L    Y  + +P V +S     EGD         +W  K   L+ A+D +I +P+R ++KP  +P++DV+ I G GTV  GR E G+LKP   V
Sbjct:   52 IDKAPEEKARGITISIAHVEYQTEARHYAHVDCPGHADYIKNMITGAAQMDGAILVVAATDGPMP-------QTREHVLLARQVGVPYIVVALNKSDMVD---DEELLELVELEVRELLSSQEYPGDDLPVVRVSALKALEGDP--------EWAGKLMELMTAVDTSIPQPERETEKPFLMPIEDVFTITGRGTVVTGRAERGILKPNEEV 245          
BLAST of DC900195 vs. ExPASy Swiss-Prot
Match: EFTU_OCHA4 (Elongation factor Tu OS=Ochrobactrum anthropi (strain ATCC 49188 / DSM 6882 / NCTC 12168) GN=tuf1 PE=3 SV=1)

HSP 1 Score: 119.398 bits (298), Expect = 2.207e-26
Identity = 79/215 (36.74%), Postives = 115/215 (53.49%), Query Frame = 1
Query:   43 FKYAWVLDKLKAERERGITIDIALWKFETTKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIVK-EVSSYLKKVGYNPEKVPFVPISGFEGDNMIERSTNLDWYKGPTLLDALDN-INEPKRPSDKPLRLPLQDVYKIGGIGTVPVGRVETGVLKPGMXV 681
            FK    +D    ER RGITI  A  ++ET   +   +D PGH D++KNMITG +Q D A+L++ +  G          QTREH LLA  +GV  ++   NK D    +   A   E+V+ EV   L K  +  ++VP +  S      + + S  L      +L+ A+D+ I  P+RP D+P  +P++DV+ I G GTV  GRVE G++K G  V
Sbjct:   39 FKAYDQIDAAPEERARGITISTAHVEYETPNRHYAHVDCPGHADYVKNMITGAAQMDGAILVVSAADGPMP-------QTREHILLARQVGVPAIVVFLNKCD----QVDDAELLELVELEVRELLSKYDFPGDEVPIIKGSALAA--LEDSSKELGEDAVRSLMAAVDDYIPTPERPIDQPFLMPIEDVFSISGRGTVVTGRVERGIVKVGEEV 240          
BLAST of DC900195 vs. ExPASy Swiss-Prot
Match: EFTU_MYCPU (Elongation factor Tu OS=Mycoplasma pulmonis GN=tuf PE=3 SV=1)

HSP 1 Score: 119.398 bits (298), Expect = 2.207e-26
Identity = 73/205 (35.61%), Postives = 111/205 (54.15%), Query Frame = 1
Query:   61 LDKLKAERERGITIDIALWKFETTKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIVKEVSSYLKKVGYNPEKVPFV---PISGFEGDNMIERSTNLDWYKGPTLLDALDN-INEPKRPSDKPLRLPLQDVYKIGGIGTVPVGRVETGVL 663
            +D    E+ RGITI+ A  ++ET K +   +D PGH D++KNMITG +Q D  +L++ +T G          QTREH LL+  +GV +M+   NK+D    +       E+  E+ S L + G++ +K P +    +   EG+   E++          L+DA+DN I  P +  DKP  L ++DV+ I G GTV  G+VE G L
Sbjct:   50 IDAAPEEKARGITINTAHIEYETEKRHYAHVDCPGHADYVKNMITGAAQMDGGILVVSATDGPMP-------QTREHILLSKQVGVPKMVVFLNKVDMLEGEDEMIELVEL--EIRSLLSEYGFDGDKTPIIKGSALKALEGNPQYEKNIE-------ELMDAVDNYIETPVKELDKPFLLAVEDVFTITGRGTVATGKVERGQL 238          
The following BLAST results are available for this feature:
BLAST of DC900195 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 500
Match NameE-valueIdentityDescription
EFTU_LEUCK1.690e-2635.81Elongation factor Tu OS=Leuconostoc citreum (strai... [more]
EFTU_GEOUR1.690e-2634.80Elongation factor Tu OS=Geobacter uraniireducens (... [more]
EFTU_CHLL21.690e-2636.41Elongation factor Tu OS=Chlorobium limicola (strai... [more]
CYSN_METPB1.690e-2633.78Sulfate adenylyltransferase subunit 1 OS=Methyloba... [more]
CYSN_FRATT1.690e-2636.28Sulfate adenylyltransferase subunit 1 OS=Francisel... [more]
CYSN_FRAT11.690e-2636.28Sulfate adenylyltransferase subunit 1 OS=Francisel... [more]
EFTU_SYNFM2.207e-2635.43Elongation factor Tu OS=Syntrophobacter fumaroxida... [more]
EFTU_SALAI2.207e-2636.79Elongation factor Tu OS=Salinispora arenicola (str... [more]
EFTU_OCHA42.207e-2636.74Elongation factor Tu OS=Ochrobactrum anthropi (str... [more]
EFTU_MYCPU2.207e-2635.61Elongation factor Tu OS=Mycoplasma pulmonis GN=tuf... [more]

Pages

back to top
Properties
Property NameValue
Genbank descriptionDC900195 VSS Citrus sinensis cDNA clone VS28233 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900195 ID=DC900195|Name=DC900195|organism=Citrus sinensis|type=EST|length=770bp
GAGAGGTTCGAGAAGGAAGCTGCTGAGATGAACAAGAGGTCATTCAAGTA
CGCCTGGGTGCTCGACAAGCTCAAGGCTGAGCGTGAACGTGGTATTACCA
TTGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTC
ATTGATGCTCCCGGACATCGTGACTTTATCAAGAACATGATTACCGGTAC
CTCACAGGCTGACTGTGCCGTCCTTATCATTGACTCCACCACCGGTGGTT
TTGAAGCTGGTATCTCCAAGGATGGTCAGACTCGTGAGCATGCTTTGCTT
GCTTTCACCCTTGGTGTGAAGCAGATGATTTGCTGCTGTAACAAGATGGA
CGCCACCACCCCCAAGTACTCAAAGGCTAGGTACGATGAAATTGTGAAGG
AGGTCTCTTCCTACCTGAAGAAGGTTGGATACAACCCCGAGAAAGTCCCA
TTCGTGCCCATCTCTGGTTTCGAGGGTGACAACATGATTGAGAGGTCTAC
CAACCTTGACTGGTACAAGGGTCCAACCCTGCTGGACGCTCTTGACAATA
TCAATGAGCCAAAGAGGCCCTCAGACAAGCCCCTTCGTCTGCCACTCCAG
GACGTGTACAAGATTGGTGGCATTGGAACCGTCCCAGTGGGTCGCGTTGA
GACCGGTGTCCTCAAGCCTGGTATGGNGGTGACATTTGGCCCCTCTGGAT
TGACAACTGAGGTAAGTCTGTTGAGATGCACCACGAGCTNTGCAGGAGGC
CTTCCGGTGACATGTTGGCT
back to top