DC900116

Overview
NameDC900116
Unique NameDC900116
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1107
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3510 contig Csv1_Contig3510:263..1369. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_BRASO (Phosphoenolpyruvate carboxykinase [ATP] OS=Bradyrhizobium sp. (strain ORS278) GN=pckA PE=3 SV=1)

HSP 1 Score: 313.153 bits (801), Expect = 1.803e-84
Identity = 154/271 (56.83%), Postives = 189/271 (69.74%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAI-KFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGI-KEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D NR LIGDDEH WG +GV N EGGCYAKCI LS+E EP I+ A  +FGAVLENVV DE +R  D+ D S TENTR+AYP++YIPNA      PHPKNV++LA DAFGVLPP++KL+ AQ MYHF+SGYTA VAGTE G+  EP   FS CFG+ F+ L P+ Y  ML + +  H    WLVNTGW+GG YG GSR+ +  TR ++ A   GSL N  ++    FG  +PT + GVPSEILDP NTW DK  + +T   L G+F++NF  F
Sbjct:  247 DPNRTLIGDDEHGWGPSGVFNFEGGCYAKCIKLSQEAEPQIFAASNRFGAVLENVVLDEDSRVPDFDDGSKTENTRSAYPLDYIPNASRTGRAPHPKNVVMLAADAFGVLPPIAKLSPAQAMYHFLSGYTAKVAGTERGLGSEPQPEFSTCFGSPFLPLDPSVYGNMLRQLIADHNVDCWLVNTGWTGGKYGTGSRMPIKVTRALLTAALDGSLRNVEFRTDKYFGFAVPTALPGVPSEILDPVNTWKDKVEFDKTARALVGMFQKNFAKF 517          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_BACLD (Phosphoenolpyruvate carboxykinase [ATP] OS=Bacillus licheniformis (strain DSM 13 / ATCC 14580) GN=pckA PE=3 SV=1)

HSP 1 Score: 313.153 bits (801), Expect = 1.803e-84
Identity = 150/271 (55.35%), Postives = 183/271 (67.53%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIFTN 877
            D  R LIGDDEH W   GV NIEGGCYAKCI+LS EKEP I+NAI+FG+VLENVV D  T E DYSD   TENTRAAYPI+ I N   P +  HP+ ++ L  DAFGVLPP+SKL   Q MYHF+SGYT+ +AGTE GI  P ATFS CFG+ F+ L    YA ML  K+ +HG   +LVNTGW+GG YG G R+ L YTR ++ A   G L  A  +   +FG+  P  V GVP ++LDP  TW D+  Y+E  + LA  FK+NF+ F+N
Sbjct:  245 DPKRKLIGDDEHGWSSTGVFNIEGGCYAKCINLSEEKEPQIYNAIRFGSVLENVVVDSKTGEPDYSDSFYTENTRAAYPIDAIDNIVKPSIAAHPQTIVFLTADAFGVLPPISKLTKEQAMYHFLSGYTSKLAGTERGITTPEATFSTCFGSPFLPLPAHVYAEMLGRKIDEHGVGVFLVNTGWTGGGYGTGERMSLAYTRAMVQAAIEGELDKAEMRTDRIFGLHSPVHVPGVPDQVLDPAKTWTDENEYEEKAIHLAKAFKQNFKKFSN 515          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_FLAJ1 (Phosphoenolpyruvate carboxykinase [ATP] OS=Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / UW101) GN=pckA PE=3 SV=1)

HSP 1 Score: 312.768 bits (800), Expect = 2.354e-84
Identity = 162/307 (52.77%), Postives = 196/307 (63.84%), Query Frame = 2
Query:    2 KDGXVAXXXXXXXXXXXXXXXDHNRYLIGDDEHCW-GDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRN---FEIFTNYKIGKDNKLTE 910
            KDG  A               D  R LIGDDEH W  +N V N EGGCYAK I+L+ E EPDI+ AIK GA+LENVVF   T EVD+ D S+T+NTR +YPI +I N +   +G +PKN+  L  D+FG+LPP+SKL   Q  YHFISGYTA VAGTE G+ EP   FSACFGA F+ LHPTKYA ML++KM+      WL+NTGW+GG+YG GSR+KL YTR +I A  +G L N  Y    VFG+  P     VPSEIL+P NTW DK  Y +  L+LA  FK N   FE F N +I     +TE
Sbjct:  228 KDGDTAIFFGLSGTGKTTLSADPERKLIGDDEHGWTAENTVFNFEGGCYAKVINLTEENEPDIFRAIKKGALLENVVFKAGTNEVDFDDVSITQNTRVSYPITHIDNIQPGSIGHNPKNIFFLTADSFGILPPISKLTPGQAAYHFISGYTAKVAGTEAGVTEPQPNFSACFGAPFMPLHPTKYAEMLSKKMKDADVKVWLINTGWTGGAYGTGSRMKLKYTRAMITAALNGELDNVEYVNHKVFGIAKPQSCPNVPSEILNPRNTWEDKDLYDKKALELAQKFKANFAKFEEFANAEILAGAPITE 534          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_BRAJA (Phosphoenolpyruvate carboxykinase [ATP] OS=Bradyrhizobium japonicum GN=pckA PE=3 SV=1)

HSP 1 Score: 312.768 bits (800), Expect = 2.354e-84
Identity = 153/271 (56.46%), Postives = 189/271 (69.74%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNA-IKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGI-KEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D NR LIGDDEH WG NGV N EGGCYAKCI LS+E EP I+ A  +FGAVLEN V DE TR VD+ D S TENTR+AYP+++IPNA      P PKNV++LA DAFGVLPP++KL+ AQ MYHF+SGYTA VAGTE G+  EP   FS CFG+ F+ L P+ Y  ML + + +H    WLVNTGW+GG YG GSR+ +  TR ++ A   GSL N  ++    FG  +PT + GVPSEIL+P NTW DK  + +T   L G+F++NF  F
Sbjct:  248 DPNRTLIGDDEHGWGPNGVFNFEGGCYAKCIKLSQEAEPQIYAASTRFGAVLENCVLDEDTRVVDFDDGSKTENTRSAYPLDFIPNASRTGRAPQPKNVVMLAADAFGVLPPIAKLSPAQAMYHFLSGYTAKVAGTERGLGNEPQPEFSTCFGSPFLPLDPSVYGNMLRDLIAQHNVDCWLVNTGWTGGKYGTGSRMPIKVTRALLTAALDGSLRNVEFRTDKYFGFAVPTALPGVPSEILNPVNTWKDKDEFDKTARALVGMFQKNFAKF 518          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_BACP2 (Phosphoenolpyruvate carboxykinase [ATP] OS=Bacillus pumilus (strain SAFR-032) GN=pckA PE=3 SV=1)

HSP 1 Score: 312.768 bits (800), Expect = 2.354e-84
Identity = 148/269 (55.02%), Postives = 185/269 (68.77%), Query Frame = 2
Query:   71 NRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIFTN 877
            +R LIGDDEH W  +GV NIEGGCYAKC++LS EKEP I+ AI FG+VLENVV DE TRE DY D   TENTRAAYPIE I N   P +  HP  ++ L  DAFGVLPP+S+L   Q MYHF+SGYT+ +AGTE G+  P  TFS CFG+ F+ L    YA ML +K+ +HGA  +LVNTGW+GG YG G R+ L +TR ++ A   G L NA     D+FG+ IP  + GVP E+L P  TW D++AY+E    LA  FK+NF+ F++
Sbjct:  247 SRKLIGDDEHGWSGSGVFNIEGGCYAKCVNLSEEKEPQIYKAISFGSVLENVVLDEETREADYDDTFFTENTRAAYPIEMIDNIVKPSIAGHPSAIVFLTADAFGVLPPISRLTKEQAMYHFLSGYTSKLAGTERGVTSPETTFSTCFGSPFLPLPAHVYAEMLGKKIDEHGAKVFLVNTGWTGGGYGTGKRMNLAHTRAMVQAAIEGDLDNAEMITDDIFGLHIPLHIPGVPDEVLQPSKTWDDQEAYQEKAHFLANEFKKNFQKFSH 515          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_RHOP2 (Phosphoenolpyruvate carboxykinase [ATP] OS=Rhodopseudomonas palustris (strain HaA2) GN=pckA PE=3 SV=1)

HSP 1 Score: 312.383 bits (799), Expect = 3.075e-84
Identity = 153/270 (56.67%), Postives = 187/270 (69.26%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAI-KFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D NR LIGDDEH WG +GV N EGGCYAKCI LS E EP+I+ A  +FGAVLENVV DE TR+ D+ D S TENTR+AYP+E IPNA +      PKNV++LA DAFGV+PP++KL  AQ MYHF+SGYTA VAGTE G+ EP   FS CFG+ F+   P+ Y  ML E + KH    WLVNTGW+GG YG G R+ +  TR ++ A   GSL N  ++    FG  +PT + GVPS+ILDP  TWADK A+  T  KL G+F++NF  F
Sbjct:  248 DPNRTLIGDDEHGWGKDGVFNFEGGCYAKCIKLSPEAEPEIFAASSRFGAVLENVVLDEITRKPDFDDGSKTENTRSAYPLESIPNASLTGRAGQPKNVVMLAADAFGVMPPIAKLTPAQAMYHFLSGYTAKVAGTERGVTEPEPEFSTCFGSPFLPRDPSVYGNMLRELIAKHDVDCWLVNTGWTGGIYGTGHRMPIKVTRALLTAALDGSLRNVEFRTDPYFGFAVPTSLHGVPSDILDPVKTWADKAAFDATARKLVGMFQKNFAKF 517          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_RHOPT (Phosphoenolpyruvate carboxykinase [ATP] OS=Rhodopseudomonas palustris (strain TIE-1) GN=pckA PE=3 SV=1)

HSP 1 Score: 311.997 bits (798), Expect = 4.016e-84
Identity = 153/270 (56.67%), Postives = 186/270 (68.89%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNA-IKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D NR LIGDDEH WG +GV N EGGCYAKCI LS E EP+I+ A  +FGAVLENVV  E  R+ D+ D S TENTR+AYP+E IPNA +      PKNV++LA DAFGV+PP++KL  AQ MYHF+SGYTA VAGTE G+ EPT  FS CFG+ F+   P+ Y  ML E + KH    WLVNTGW+GG YG G R+ +  TR ++ A   GSL N  ++    FG  +PT + GVPSEILDP  TWADK A+  T  KL G+F++NF  F
Sbjct:  248 DPNRTLIGDDEHGWGKDGVFNFEGGCYAKCIKLSAENEPEIYAASTRFGAVLENVVLGEIDRKPDFDDGSKTENTRSAYPLESIPNASLTGRAGQPKNVVMLAADAFGVMPPIAKLTPAQAMYHFLSGYTAKVAGTERGVTEPTPEFSTCFGSPFLPRDPSVYGNMLRELIAKHNVDCWLVNTGWTGGIYGTGHRMPIKVTRALLTAALDGSLRNVEFRTDPYFGFAVPTALPGVPSEILDPVKTWADKAAFDTTARKLVGMFQKNFAKF 517          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_RHOPB (Phosphoenolpyruvate carboxykinase [ATP] OS=Rhodopseudomonas palustris (strain BisB18) GN=pckA PE=3 SV=1)

HSP 1 Score: 311.997 bits (798), Expect = 4.016e-84
Identity = 153/270 (56.67%), Postives = 187/270 (69.26%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAI-KFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D NR LIGDDEH WG +GV N EGGCYAKCI LS E EP+I+ A  +FGA+LEN V D  TR+ D++D S TENTR+AYP+E IPNA        PKNV++LA DAFGV+PP++KL+ AQ MYHF+SGYTA VAGTE G+ EPT  FS CFG+ F+   P+ Y  ML E + KHG   WLVNTGW+GG YG G R+ +  TR ++ A   GSL N  +K    FG  +PT + GVPSEILDP  TWADK A+  T  KL  +F++NF  F
Sbjct:  248 DPNRTLIGDDEHGWGKDGVFNFEGGCYAKCIKLSAEAEPEIFAASNRFGAILENCVLDPITRKPDFNDGSKTENTRSAYPLESIPNASPTGRAGQPKNVVMLAADAFGVMPPIAKLSPAQAMYHFLSGYTAKVAGTERGVTEPTPVFSTCFGSPFLPRDPSVYGNMLRELIAKHGVDCWLVNTGWTGGMYGTGHRMPIKVTRALLTAALDGSLRNVEFKTDPYFGFAVPTALPGVPSEILDPVKTWADKAAFDTTARKLVAMFQKNFTQF 517          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_RHOPA (Phosphoenolpyruvate carboxykinase [ATP] OS=Rhodopseudomonas palustris GN=pckA PE=1 SV=2)

HSP 1 Score: 311.997 bits (798), Expect = 4.016e-84
Identity = 153/270 (56.67%), Postives = 186/270 (68.89%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNA-IKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D NR LIGDDEH WG +GV N EGGCYAKCI LS E EP+I+ A  +FGAVLENVV  E  R+ D+ D S TENTR+AYP+E IPNA +      PKNV++LA DAFGV+PP++KL  AQ MYHF+SGYTA VAGTE G+ EPT  FS CFG+ F+   P+ Y  ML E + KH    WLVNTGW+GG YG G R+ +  TR ++ A   GSL N  ++    FG  +PT + GVPSEILDP  TWADK A+  T  KL G+F++NF  F
Sbjct:  248 DPNRTLIGDDEHGWGKDGVFNFEGGCYAKCIKLSSENEPEIYAASTRFGAVLENVVLGELDRKPDFDDGSKTENTRSAYPLESIPNASLTGRAGQPKNVVMLAADAFGVMPPIAKLTPAQAMYHFLSGYTAKVAGTERGVTEPTPEFSTCFGSPFLPRDPSVYGNMLRELIAKHNVDCWLVNTGWTGGIYGTGHRMPIKVTRALLTAALDGSLRNVEFRTDPYFGFAVPTALPGVPSEILDPVKTWADKAAFDTTARKLVGMFQKNFAKF 517          
BLAST of DC900116 vs. ExPASy Swiss-Prot
Match: PCKA_AMOA5 (Phosphoenolpyruvate carboxykinase [ATP] OS=Amoebophilus asiaticus (strain 5a2) GN=pckA PE=3 SV=1)

HSP 1 Score: 311.612 bits (797), Expect = 5.245e-84
Identity = 145/269 (53.90%), Postives = 188/269 (69.89%), Query Frame = 2
Query:   65 DHNRYLIGDDEHCWGDNGVSNIEGGCYAKCIDLSREKEPDIWNAIKFGAVLENVVFDEHTREVDYSDKSVTENTRAAYPIEYIPNAKIPCVGPHPKNVILLACDAFGVLPPVSKLNLAQTMYHFISGYTALVAGTEDGIKEPTATFSACFGAAFIMLHPTKYAAMLAEKMQKHGATGWLVNTGWSGGSYGCGSRIKLPYTRKIIDAIHSGSLLNANYKKTDVFGVEIPTEVEGVPSEILDPENTWADKQAYKETLLKLAGLFKRNFEIF 871
            D NR LIGDDEH W D G+ N EGGCYAK I+L++E EP I++AIKFG ++EN+ F   TR +DY D S+TEN R AYP+EYIP A IP +G  PK++  L+CDA+GVLPP+S+L+  Q +++F+SGYTA +AGTE GI  P A FSACFGA F+ LHPT+YA MLA+K++K+  T WLVNTGW GG YG G RI L YTR ++ A  SG L  A ++K  +F + IP     VP+ IL+P NTW   + Y+    KL   F  NF ++
Sbjct:  250 DPNRKLIGDDEHGWCDKGIFNFEGGCYAKTINLAKESEPQIFDAIKFGTIVENMRFFAGTRTIDYKDSSITENVRCAYPLEYIPGALIPSIGSIPKHIFFLSCDAYGVLPPISQLDKDQAIHYFLSGYTAKIAGTEAGISAPKAVFSACFGAPFLPLHPTRYATMLADKLEKYEVTVWLVNTGWIGGGYGIGKRIDLNYTRAMVTAALSGELAKAGFEKDAIFNLSIPNACPEVPTHILNPSNTWNSVKEYELEAHKLMEAFASNFALY 518          
The following BLAST results are available for this feature:
BLAST of DC900116 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 284
Match NameE-valueIdentityDescription
PCKA_BRASO1.803e-8456.83Phosphoenolpyruvate carboxykinase [ATP] OS=Bradyrh... [more]
PCKA_BACLD1.803e-8455.35Phosphoenolpyruvate carboxykinase [ATP] OS=Bacillu... [more]
PCKA_FLAJ12.354e-8452.77Phosphoenolpyruvate carboxykinase [ATP] OS=Flavoba... [more]
PCKA_BRAJA2.354e-8456.46Phosphoenolpyruvate carboxykinase [ATP] OS=Bradyrh... [more]
PCKA_BACP22.354e-8455.02Phosphoenolpyruvate carboxykinase [ATP] OS=Bacillu... [more]
PCKA_RHOP23.075e-8456.67Phosphoenolpyruvate carboxykinase [ATP] OS=Rhodops... [more]
PCKA_RHOPT4.016e-8456.67Phosphoenolpyruvate carboxykinase [ATP] OS=Rhodops... [more]
PCKA_RHOPB4.016e-8456.67Phosphoenolpyruvate carboxykinase [ATP] OS=Rhodops... [more]
PCKA_RHOPA4.016e-8456.67Phosphoenolpyruvate carboxykinase [ATP] OS=Rhodops... [more]
PCKA_AMOA55.245e-8453.90Phosphoenolpyruvate carboxykinase [ATP] OS=Amoebop... [more]

Pages

back to top
Properties
Property NameValue
Genbank descriptionDC900116 VSS Citrus sinensis cDNA clone VS27V30 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900116 ID=DC900116|Name=DC900116|organism=Citrus sinensis|type=EST|length=1107bp
AAAAGATGGCNATGTTGCCCTCTTCTTTGGATTGTCAGGTACTGGAAAGA
CAACACTGTCTACTGATCACAATCGATATCTGATTGGAGACGATGAACAC
TGTTGGGGTGACAATGGTGTGTCAAACATTGAGGGTGGTTGCTATGCCAA
GTGCATTGATCTCTCAAGGGAGAAGGAGCCTGATATCTGGAATGCCATCA
AGTTTGGCGCTGTGTTGGAAAATGTTGTGTTTGATGAGCATACCAGAGAG
GTGGATTATTCTGACAAATCTGTCACAGAGAACACTCGTGCTGCCTACCC
CATTGAGTATATCCCCAATGCAAAGATACCATGCGTTGGTCCTCATCCCA
AGAATGTCATCCTTTTGGCATGTGATGCTTTTGGTGTACTCCCACCAGTG
AGCAAGCTGAACCTGGCACAAACAATGTACCATTTCATCAGTGGCTACAC
TGCTTTGGTAGCTGGAACAGAGGATGGTATTAAGGAGCCAACGGCAACAT
TTTCAGCTTGCTTTGGTGCAGCATTTATCATGCTGCATCCTACCAAGTAT
GCAGCAATGCTGGCTGAGAAGATGCAGAAGCATGGTGCTACAGGATGGCT
CGTCAACACTGGATGGTCAGGTGGAAGCTATGGTTGTGGCAGCCGCATCA
AGTTACCGTACACTCGAAAAATCATTGATGCGATACACTCTGGCAGCCTG
TTGAATGCAAATTACAAGAAAACTGATGTATTTGGGGTGGAAATCCCCAC
TGAAGTCGAGGGAGTGCCTTCAGAAATCCTGGATCCAGAGAACACTTGGG
CAGACAAGCAGGCTTACAAGGAGACACTGCTGAAGCTGGCTGGTCTTTTC
AAGAGGAACTTTGAAATATTCACAAACTACAAGATTGGCAAGGACAACAA
GCTCACTGAAGAGATCCTTGNANCTGGTCCAAATTTCTAATTTAGACCGA
GTGAAGAACAAGCAAAGAACGTGAGTGTGGTTTGGGAAATATGATGGAAA
TAAAGCGTAATATAGTCATATTCGACATGTGTGGTTCGATTCATATGTAA
ACTTGTTCTCCTGNATTAATTAAGTAATCCAAAAATTTGAGTCANCGATT
TTAATTA
back to top