DC900009

Overview
NameDC900009
Unique NameDC900009
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length664
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Homology
BLAST of DC900009 vs. ExPASy Swiss-Prot
Match: Y4527_DICDI (COBW domain-containing protein DDB_G0274527 OS=Dictyostelium discoideum GN=DDB_G0274527 PE=3 SV=1)

HSP 1 Score: 67.3958 bits (163), Expect = 7.602e-11
Identity = 46/157 (29.30%), Postives = 78/157 (49.68%), Query Frame = 1
Query:    1 ERLDHILLETTGLANPAPLASVLWLD-----DQLESAVRLDSIITVVDAKNLLFQI-------DKYRHLSSYPEA------IHQIAFADVVILNKVDLVSPERSGDSLDELEKEIHEINSLAHVIHSVRCQVDLSEVLNCRAYDATHVTRLEGLLEE 417
            +R D++++E++G++ P P+A     +     + L+   +LD+++TVVD    L Q        DK    +   E       + Q+ F++V++LNK DLVS ER    +  +E  I  IN  A ++ S    V L E+LN   +D    +   G L+E
Sbjct:  136 KRFDYLIIESSGISEPLPIAETFTFEIDGSIENLKDYTKLDTMVTVVDCSTWLEQYQSGESLKDKDMQATDQDERSLVDLLLDQVEFSNVILLNKCDLVSEER----VKTIEGLIKHINPEARLLRSTNSVVPLKEILNTGLFDFKKASEHPGWLKE 288          
The following BLAST results are available for this feature:
BLAST of DC900009 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 11
Match NameE-valueIdentityDescription
Y4527_DICDI7.602e-1129.30COBW domain-containing protein DDB_G0274527 OS=Dic... [more]

Pages

back to top
Properties
Property NameValue
Genbank descriptionDC900009 VSS Citrus sinensis cDNA clone VS27Q21 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900009 ID=DC900009|Name=DC900009|organism=Citrus sinensis|type=EST|length=664bp
GAAAGACTTGATCATATTTTGCTCGAGACCACTGGGTTAGCAAATCCTGC
TCCTCTGGCATCTGTTCTTTGGTTGGATGACCAGCTGGAATCAGCTGTCA
GGCTTGATTCTATTATCACTGTTGTGGATGCCAAAAATCTTCTTTTCCAG
ATTGATAAGTATCGTCACTTGTCTTCGTATCCTGAAGCAATTCATCAAAT
AGCATTTGCTGATGTTGTGATTCTTAACAAGGTCGATTTAGTTTCTCCAG
AGCGTTCTGGAGATTCTCTTGATGAATTGGAGAAGGAAATACATGAAATT
AACTCCCTTGCCCATGTCATCCACTCTGTTCGATGTCAAGTTGACCTGTC
TGAAGTATTGAATTGTCGAGCATATGATGCCACACATGTCACTCGTCTAG
AAGGACTGTTGGAGGAACACCAATATAAATCTTCTCAGAATCTTCATGAC
AATAATGTGCGAACCTTGTCCATTTGTGAACCACTGGCAGTTAATCTTGA
TAAGGTTCGCTTATGGCTTGAGGAGATTCTTTGGGATAAAAAGATGTATG
GATGTGTNCCGTTGCAAGGGGTTTAAGGGTTAACACTCCGATCACTGCTA
CTTGCAGGCTGGGNGGAGATTATGAGATGGTCCGCTCGAAATGGGAACCG
GGGGATCCGTGATA
back to top