92-R, 92-R (genetic_marker) Citrus sinensis | Citrus Genome Database

Marker Overview

Marker Overview


Name	92-R
Genbank ID	N/A
Type	gene marker
Species	Citrus sinensis
Primer 1	92-R.Reverse Primer: CAGTGTTAGTCCCATAGCCT
Product Length	221
Publication	[view all]
Contact	Z Li

Contact

Name

Details

Z Li

First name:	Z
Last name:	Li
Title:	Researcher
Institution:	Chongqing University
Address:	College of Bio-Engineering, Genetic Engineering Research Center, Chongqing University, Chongqing, 400044 China

Publications


Year	Publication
2006	Gao X, Li Z, Fan J, Yang Y. Screening and expression of differentially expressed genes for peel pitting of citrus fruit. Acta horticulturae. 2006; (712)473-479.