P2, P2 (genetic_marker) Poncirus trifoliata | Citrus Genome Database

Marker Overview

Marker Overview


Name	P2
Genbank ID	CN779664
Type	gene marker
Species	Poncirus trifoliata
Primer 1	P2.Forward Primer: GCCATCCCATTCAAGTCCAA
Primer 2	P2.Reverse Primer: GAATCGGCCATGAACATGTA
Product Length	259
Publication	[view all]
Contact	Fenny Dane

Contact

Name

Details

Fenny Dane

First name:	Fenny
Last name:	Dane
Title:	Researcher
Institution:	Auburn University
Address:	Department of Horticulture, Auburn University, Auburn, AL 36849, USA
Country:	USA
Email:	danefen@auburn.edu

Publications


Year	Publication
2011	Huang Y, Si Y, Dane F. Impact of grafting on cold responsive gene expression in Satsuma mandarin (Citrus unshiu). Euphytica. 2011; 177(1):25-32.
2005	Zhang C, Lang P, Dane F, Ebel R, Singh N, Locy R, Dozier W. Cold acclimation induced genes of trifoliate orange (Poncirus trifoliata). Plant cell reports. 2005; 23(10-11):764-769.