Ma4_35, Ma4_35 (genetic_marker) Citrus sinensis | Citrus Genome Database

Marker Overview

Marker Overview


Name	Ma4_35
Genbank ID	N/A
Type	SSR
Species	Citrus sinensis
Primer 1	Ma4_35.Forward Primer: CACCACACAAGGCTCAAATG
Primer 2	Ma4_35.Reverse Primer: CAGTTCACACCACCGTCAAC
Publication	[view all]
Contact	X.X. Deng

Contact

Name

Details

X.X. Deng

First name:	X.X.
Last name:	Deng
Title:	Researcher
Institution:	Huazhong Agricultural University
Address:	National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, P.R. China
Country:	China
Email:	dxxwwlj@public.wh.hb.cn

Publications


Year	Publication
2013	Xu Q, Chen LL, Ruan X, Chen D, Zhu A, Chen C, Bertrand D, Jiao WB, Hao BH, Lyon MP, Chen J, Gao S, Xing F, Lan H, Chang JW, Ge X, Lei Y, Hu Q, Miao Y, Wang L, Xiao S, Biswas MK, Zeng W, Guo F, Cao H, Yang X, Xu XW, Cheng YJ, Xu J, Liu JH, Luo OJ, Tang Z, Guo WW, Kuang H, Zhang HY, Roose ML, Nagarajan N, Deng XX, Ruan Y. The draft genome of sweet orange (Citrus sinensis). Nature genetics. 2013 Jan; 45(1):59-66.