Sc_9_06

Marker Overview
NameSc_9_06
Genbank IDN/A
TypeSSR
SpeciesCitrus clementina
Repeat Motif(TTTATT)5
Primer 1Sc_9_06.Forward: TGGTGAAGCCTACCCTTT
Primer 2Sc_9_06.Reverse: GCATTGCCTCCCTTCTGGAT
Product Length457
Publication[view all]
ContactKwan Song
Contact
NameDetails
Kwan Song
First name:Kwan
Last name:Song
Institution:Jeju National University
Country:Korea
Email:kwansong@jejunu.ac.kr
Last update:Apr 2018
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardSc_9_06.ForwardCitrus clementinaprimer
ReverseSc_9_06.ReverseCitrus clementinaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Sc_9_06Sc_9_06Citrus clementinamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Fina_Sodea/Byungkyool-F1-Fina_SodeaC05N/A29.5Sc_9_06View