Sc_7_14

Marker Overview
NameSc_7_14
Genbank IDN/A
TypeSSR
SpeciesCitrus clementina
Repeat Motif(ATT)8
Primer 1Sc_7_14.Forward: ACAAACCAATGGAGAGCACCA
Primer 2Sc_7_14.Reverse: TGCTTTTGATGCAGAAGGGAG
Product Length496
Publication[view all]
ContactKwan Song
Contact
NameDetails
Kwan Song
First name:Kwan
Last name:Song
Institution:Jeju National University
Country:Korea
Email:kwansong@jejunu.ac.kr
Last update:Apr 2018
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardSc_7_14.ForwardCitrus clementinaprimer
ReverseSc_7_14.ReverseCitrus clementinaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Sc_7_14Sc_7_14Citrus clementinamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Fina_Sodea/Byungkyool-F1-ByungkyoolB02N/A65.4Sc_7_14View