Sc_7_05

Marker Overview
NameSc_7_05
Genbank IDN/A
TypeSSR
SpeciesCitrus clementina
Repeat Motif(AAT)5c(AAT)5
Primer 1Sc_7_05.Forward: GATAACTTGCCCGTTGCG
Primer 2Sc_7_05.Reverse: AGGCGAATTAAACTGTCATGA
Product Length420
Publication[view all]
ContactKwan Song
Contact
NameDetails
Kwan Song
First name:Kwan
Last name:Song
Institution:Jeju National University
Country:Korea
Email:kwansong@jejunu.ac.kr
Last update:Apr 2018
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardSc_7_05.ForwardCitrus clementinaprimer
ReverseSc_7_05.ReverseCitrus clementinaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Sc_7_05Sc_7_05Citrus clementinamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Fina_Sodea/Byungkyool-F1-ByungkyoolB02N/A9.9Sc_7_05View