Sc_7_01

Marker Overview
NameSc_7_01
Genbank IDN/A
TypeSSR
SpeciesCitrus clementina
Repeat Motif(ATG)6
Primer 1Sc_7_01.Forward: CCAATATAGCCAGTCCCC
Primer 2Sc_7_01.Reverse: ACAAGTCGTGTCTGGCTAGC
Product Length466
Publication[view all]
ContactKwan Song
Contact
NameDetails
Kwan Song
First name:Kwan
Last name:Song
Institution:Jeju National University
Country:Korea
Email:kwansong@jejunu.ac.kr
Last update:Apr 2018
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardSc_7_01.ForwardCitrus clementinaprimer
ReverseSc_7_01.ReverseCitrus clementinaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Sc_7_01Sc_7_01Citrus clementinamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Fina_Sodea/Byungkyool-F1-ByungkyoolB02N/A22.1Sc_7_01View