Sc_4_15

Marker Overview
NameSc_4_15
Genbank IDN/A
TypeSSR
SpeciesCitrus clementina
Repeat Motif(AATT)5
Primer 1Sc_4_15.Forward: CCATCTGGCGTTGCGATAAT
Primer 2Sc_4_15.Reverse: AGGCGACGGTTGAACATCAT
Product Length179
Publication[view all]
ContactKwan Song
Contact
NameDetails
Kwan Song
First name:Kwan
Last name:Song
Institution:Jeju National University
Country:Korea
Email:kwansong@jejunu.ac.kr
Last update:Apr 2018
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardSc_4_15.ForwardCitrus clementinaprimer
ReverseSc_4_15.ReverseCitrus clementinaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Sc_4_15Sc_4_15Citrus clementinamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Fina_Sodea/Byungkyool-F1-ByungkyoolB03N/A58Sc_4_15View
2Citrus-Fina_Sodea/Byungkyool-F1-Fina_SodeaC07N/A0Sc_4_15View