Sc_1_17

Marker Overview
NameSc_1_17
Genbank IDN/A
TypeSSR
SpeciesCitrus clementina
Repeat Motif(TC)9
Primer 1Sc_1_17.Forward: CGTGGACAGCTAGCCGATAG
Primer 2Sc_1_17.Reverse: GCCACAACCCACAAACACAC
Product Length407
Publication[view all]
ContactKwan Song
Contact
NameDetails
Kwan Song
First name:Kwan
Last name:Song
Institution:Jeju National University
Country:Korea
Email:kwansong@jejunu.ac.kr
Last update:Apr 2018
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardSc_1_17.ForwardCitrus clementinaprimer
ReverseSc_1_17.ReverseCitrus clementinaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Sc_1_17Sc_1_17Citrus clementinamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Fina_Sodea/Byungkyool-F1-Fina_SodeaC04N/A0Sc_1_17View