EH406246

Overview
NameEH406246
Unique NameEH406246
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length259
Libraries
Library NameType
AbsCOv1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAB2AH04ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH406246 ID=EH406246; Name=EH406246; organism=Citrus clementina; type=EST; length=259bp
CACAGCTTGGTTGTTGGTATTTTTGGTTGAATGGCCTTTGTTTTAATTCT
CTCTCTAGGTGACTTGGAAACATTGGTCTCTTACTAAGTTGTGCTTTTGT
TTAAGAAATTTACCTATCATAGTTTGTGTTTTCAGTTTCTGCTGGGTTTT
TGAACTTATGTTTCCTAAGAGTTTAAATGTAAACATTTGCTAGGGTTATA
TAACTCAGCAAAGCTTTTGGAGGTATGAATGATGTTTAATAGACATTGAT
GCTTTTCAA
back to top