FC868640

Overview
NameFC868640
Unique NameFC868640
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length645
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC31002H12EF AbioticL1 Citrus clementina cDNA clone C31002H12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868640 ID=FC868640; Name=FC868640; organism=Citrus clementina; type=EST; length=645bp
GATTCAATAAGTAGCCCTCGCACAAAAAAAATGATTTTCCTACTACTCCT
CTCCGTTTTTCTTCGCGGAGCTTCTTCATCAATCCTTTCCGAAGACACAC
CTATTAGCTTCTCATTTCCCTCATTCGCCAAAGACAGTTGTGACAATAAG
ACCCTCATTTGCTACGGAGCGATTGAAAGTTCCGGCGCCTTAAGCATCAC
ACCAGGCCCTCCACCAAACCTGCCGATCAGAAAGGTTGGACGGGTTTTAT
ACGGCAAGCCTCTGAGTTTACAGCGATCTTTTATTGATACCACCATCACC
ATTAAGATCTCACGCCATCAGAATTACACTGATCGTGCCGGAGATGGCAT
GACGTTCATTTTTGCAAGCGATAAAAACGGTCCATCAGCAAAGGGCGTCG
GCGAATATCTTGGACTGCAGTCTTCACCAGGCGATAAATTTCCTCCATTA
GCCGTGGAGCTGGACACATGCCTGAACAAGAACCTGAATGATCCAGATGA
TAACCATATTGGCATCGACATAAACGGAATCGAATCAAATCCAGTTAATA
GTCTGCTTGACGTTGATCTCAAAAGTGGACGAGCAATCCAGGTTCGAATT
TATTACAATCCAGACTTTGGACAACTCTCTGTTTATGCGGCATAT
back to top