FC868657

Overview
NameFC868657
Unique NameFC868657
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length651
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC31003B07EF AbioticL1 Citrus clementina cDNA clone C31003B07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868657 ID=FC868657; Name=FC868657; organism=Citrus clementina; type=EST; length=651bp
AACAACGAAAGGATATGCATAGGCATAGCGGTATGGCTGACAGCACCACC
CTTACTTGTCTCGTGTTCTTAGATTCGTTTGTTAAGTCATTCGTATCTGG
ACTTAAATGGTTTCATTCCATTTTCGGTTTCAAATCCACTCAACCACGCC
ACTTGCGTCTTAATTCAATCTCTTTTTTTTTCCCCCTTCCCTCAACTCTT
GTTCGATGATAAATGTCTCCAGAATGTAATGGCAGGAGCTGAAGCAAGGG
CTGTGTGGCAGAGGGCAGCTAATCGTTGCTTTGTCCAAGAAGATGCCAAA
AGAGCTCCCAAGTTAGCTTGCTGCCAATCATCGTCTTCATCGTCCAAACA
GGTTGATGCAGGACCTGCTGGTGTAGCAGATGCACCAGATCACCCTGCTG
CAGGATTCATGCCTCTAAACATGAATCATTTGTATTCTGAACTGCCTTCT
GATACAAGATGGTGGCTTCAGCTGCAACCTAACTACGGCTGCCAAAAAGG
TTTAACAAGTGAGCAAATAAGTGCTGTGGAGGCTGAGATGGAAGCCTTGA
GAGCTGGCTTTGTCAATTCACCCTCTAAGTTCAGTGGGGACCCCTCATTA
GATAGCACCGGTGGTACTCTTGTTGATGGCAGTATAAACAATGATGTTTC
T
back to top