FC868756

Overview
NameFC868756
Unique NameFC868756
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length715
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Homology
BLAST of FC868756 vs. ExPASy Swiss-Prot
Match: AHM5_ARATH (Copper-transporting ATPase RAN1 OS=Arabidopsis thaliana GN=RAN1 PE=1 SV=1)

HSP 1 Score: 370.933 bits (951), Expect = 3.675e-102
Identity = 179/238 (75.21%), Postives = 213/238 (89.50%), Query Frame = 1
Query:    1 GRATVTTAKVFTKMDRGEFLTLVASAEASSEHPLAKAVVEYARHFHFFDDPSLNPDGQSHSKESTGSGWLLDVSDFSALPGRGIQCFISGKQVLVGNRKLLNESGITIPDHVESFVVELEESARTGILVAYDDNLIGVMGIADPVKREAAVVVEGLLKMGVRPVMVTGDNWRTAHAVAREIGIQDVMADVMPAGKADAVRSFQKDGSIVAMVGDGINDSPALAAADVGMAIGAGTDIA 714
            G+ATVTT KVF++MDRGEFLTLVASAEASSEHPLAKA+V YARHFHFFD+ +   DG++++K+   SGWLLD SDFSALPG+GIQC ++ K +LVGNRKL++E+ I IPDHVE FV +LEES +TG++VAY+  L+GVMGIADP+KREAA+VVEGLL+MGVRP+MVTGDNWRTA AVA+E+GI+DV A+VMPAGKAD +RS QKDGS VAMVGDGINDSPALAAADVGMAIGAGTD+A
Sbjct:  666 GKATVTTTKVFSEMDRGEFLTLVASAEASSEHPLAKAIVAYARHFHFFDEST--EDGETNNKDLQNSGWLLDTSDFSALPGKGIQCLVNEKMILVGNRKLMSENAINIPDHVEKFVEDLEESGKTGVIVAYNGKLVGVMGIADPLKREAALVVEGLLRMGVRPIMVTGDNWRTARAVAKEVGIEDVRAEVMPAGKADVIRSLQKDGSTVAMVGDGINDSPALAAADVGMAIGAGTDVA 901          
BLAST of FC868756 vs. ExPASy Swiss-Prot
Match: AHM7_ARATH (Putative copper-transporting ATPase 3 OS=Arabidopsis thaliana GN=HMA5 PE=2 SV=2)

HSP 1 Score: 212.616 bits (540), Expect = 1.673e-54
Identity = 109/238 (45.80%), Postives = 153/238 (64.29%), Query Frame = 1
Query:    1 GRATVTTAKVFTKMDRGEFLTLVASAEASSEHPLAKAVVEYARHFHFFDDPSLNPDGQSHSKESTGSGWLLDVSDFSALPGRGIQCFISGKQVLVGNRKLLNESGITIPDHVESFVVELEESARTGILVAYDDNLIGVMGIADPVKREAAVVVEGLLKMGVRPVMVTGDNWRTAHAVAREIGIQDVMADVMPAGKADAVRSFQKDGSIVAMVGDGINDSPALAAADVGMAIGAGTDIA 714
            G+  V   K+   M   EF  LVA+ E +SEHPLAKA+VEYA+ F    D   NP             W  +  DF ++ G+G++  + G++++VGN+ L+N+  + IPD  E  + + E+ A+TGILV+ +  LIGV+ ++DP+K  A   +  L  M ++ +MVTGDNW TA+++ARE+GI  V+A+  P  KA+ V+  Q  G +VAMVGDGINDSPAL AADVGMAIGAGTDIA
Sbjct:  669 GKPVVVKTKLLKNMVLREFYELVAATEVNSEHPLAKAIVEYAKKFR---DDEENP------------AWP-EACDFVSITGKGVKATVKGREIMVGNKNLMNDHKVIIPDDAEELLADSEDMAQTGILVSINSELIGVLSVSDPLKPSAREAISILKSMNIKSIMVTGDNWGTANSIAREVGIDSVIAEAKPEQKAEKVKELQAAGHVVAMVGDGINDSPALVAADVGMAIGAGTDIA 890          
BLAST of FC868756 vs. ExPASy Swiss-Prot
Match: COPA_STAS1 (Copper-exporting P-type ATPase A OS=Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229) GN=copA PE=3 SV=1)

HSP 1 Score: 179.874 bits (455), Expect = 1.202e-44
Identity = 99/237 (41.77%), Postives = 143/237 (60.34%), Query Frame = 1
Query:   10 TVTTAK-VFTKMDRGE-FLTLVASAEASSEHPLAKAVVEYARHFHFFDDPSLNPDGQSHSKESTGSGWLLDVSDFSALPGRGIQCFISGKQVLVGNRKLLNESGITIPDHVESFVVELEESARTGILVAYDDNLIGVMGIADPVKREAAVVVEGLLKMGVRPVMVTGDNWRTAHAVAREIGIQDVMADVMPAGKADAVRSFQKDGSIVAMVGDGINDSPALAAADVGMAIGAGTDIA 714
            T+T  K V T  D  E  L L+ASAE  SEHPLA A+V YA+  +                       LLD +DF A+PGRGI+  ISGK ++VGNR+ +N+  + I D  E  + + E+S +T +L+A +    G++ +AD VK   A  ++ L  + ++ VM+TGDN RTA A+A E+GI  ++A V+P  KA  ++S Q     +AMVGDG+ND+PAL  AD+G+AIG GT++A
Sbjct:  499 TITNGKPVVTDFDGDEEALQLLASAEKGSEHPLADAIVNYAQTMNIK---------------------LLDTTDFEAVPGRGIKANISGKNLIVGNRQFMNDENVDIKDS-EDIMTQFEKSGKTAMLIAINQEYRGMVAVADTVKDSTATAIKQLHDLNIKVVMLTGDNERTAQAIANEVGIDTIIAQVLPEEKAAKIKSLQTQDKTIAMVGDGVNDAPALVQADIGIAIGTGTEVA 713          
BLAST of FC868756 vs. ExPASy Swiss-Prot
Match: CTPV_MYCTU (Probable cation-transporting ATPase V OS=Mycobacterium tuberculosis GN=ctpV PE=3 SV=1)

HSP 1 Score: 175.252 bits (443), Expect = 2.960e-43
Identity = 96/237 (40.51%), Postives = 139/237 (58.65%), Query Frame = 1
Query:    4 RATVTTAKVFTKMDRGEFLTLVASAEASSEHPLAKAVVEYARHFHFFDDPSLNPDGQSHSKESTGSGWLLDVSDFSALPGRGIQCFISGKQVLVGNRKLLNESGITIPDHVESFVVELEESARTGILVAYDDNLIGVMGIADPVKREAAVVVEGLLKMGVRPVMVTGDNWRTAHAVAREIGIQDVMADVMPAGKADAVRSFQKDGSIVAMVGDGINDSPALAAADVGMAIGAGTDIA 714
            R  VT      +    + L L A+ E+ SEHP+  A+V  A H      P+ N                     F+A+ G G++  ++G  V+VG RKL++E  + +PDH+ +  VE EE  RT + V  D  ++GV+ +AD VK +AA VV  L  MG++  M+TGDN RTA A+A+++GI+ V+A+V+P  K   VR  Q  G +VAMVGDG+ND+PAL  AD+G+AIG GTD+A
Sbjct:  469 RMRVTDVIAGQRRQPDQVLRLAAAVESGSEHPIGAAIVA-AAHERGLAIPAANA--------------------FTAVAGHGVRAQVNGGPVVVGRRKLVDEQHLVLPDHLAAAAVEQEERGRTAVFVGQDGQVVGVLAVADTVKDDAADVVGRLHAMGLQVAMITGDNARTAAAIAKQVGIEKVLAEVLPQDKVAEVRRLQDQGRVVAMVGDGVNDAPALVQADLGIAIGTGTDVA 684          
BLAST of FC868756 vs. ExPASy Swiss-Prot
Match: COPA_STAAR (Copper-exporting P-type ATPase A OS=Staphylococcus aureus (strain MRSA252) GN=copA PE=3 SV=1)

HSP 1 Score: 172.17 bits (435), Expect = 2.505e-42
Identity = 89/219 (40.64%), Postives = 134/219 (61.19%), Query Frame = 1
Query:   58 LTLVASAEASSEHPLAKAVVEYARHFHFFDDPSLNPDGQSHSKESTGSGWLLDVSDFSALPGRGIQCFISGKQVLVGNRKLLNESGITIPDHVESFVVELEESARTGILVAYDDNLIGVMGIADPVKREAAVVVEGLLKMGVRPVMVTGDNWRTAHAVAREIGIQDVMADVMPAGKADAVRSFQKDGSIVAMVGDGINDSPALAAADVGMAIGAGTDIA 714
            L L+A+AE  SEHPLA+A+V YA+                  K+ T    L + + F A+PG GI+  I    +LVGNRKL+ ++ I++P H+   +   E   +T +L+A + +L G++ +AD VK  A   ++ L  MG+   M+TGDN  TA A+A+++GI  V+AD++P  KA  +   Q+ G  VAMVGDG+ND+PAL  AD+G+AIG GT++A
Sbjct:  517 LQLLATAEKDSEHPLAEAIVNYAKE-----------------KQLT----LTETTTFKAVPGHGIEATIDHHHILVGNRKLMADNDISLPKHISDDLTHYERDGKTAMLIAVNYSLTGIIAVADTVKDHAKDAIKQLHDMGIEVAMLTGDNKNTAQAIAKQVGIDTVIADILPEEKAAQITKLQQQGKKVAMVGDGVNDAPALVKADIGIAIGTGTEVA 714          
BLAST of FC868756 vs. ExPASy Swiss-Prot
Match: COPA_STAAN (Copper-exporting P-type ATPase A OS=Staphylococcus aureus (strain N315) GN=copA PE=1 SV=1)

HSP 1 Score: 172.17 bits (435), Expect = 2.505e-42
Identity = 89/219 (40.64%), Postives = 134/219 (61.19%), Query Frame = 1
Query:   58 LTLVASAEASSEHPLAKAVVEYARHFHFFDDPSLNPDGQSHSKESTGSGWLLDVSDFSALPGRGIQCFISGKQVLVGNRKLLNESGITIPDHVESFVVELEESARTGILVAYDDNLIGVMGIADPVKREAAVVVEGLLKMGVRPVMVTGDNWRTAHAVAREIGIQDVMADVMPAGKADAVRSFQKDGSIVAMVGDGINDSPALAAADVGMAIGAGTDIA 714
            L L+A+AE  SEHPLA+A+V YA+                  K+ T    L + + F A+PG GI+  I    +LVGNRKL+ ++ I++P H+   +   E   +T +L+A + +L G++ +AD VK  A   ++ L  MG+   M+TGDN  TA A+A+++GI  V+AD++P  KA  +   Q+ G  VAMVGDG+ND+PAL  AD+G+AIG GT++A
Sbjct:  517 LQLLATAEKDSEHPLAEAIVNYAKE-----------------KQLT----LTETTTFKAVPGHGIEATIDHHHILVGNRKLMADNDISLPKHISDDLTHYERDGKTAMLIAVNYSLTGIIAVADTVKDHAKDAIKQLHDMGIEVAMLTGDNKNTAQAIAKQVGIDTVIADILPEEKAAQIAKLQQQGKKVAMVGDGVNDAPALVKADIGIAIGTGTEVA 714          
BLAST of FC868756 vs. ExPASy Swiss-Prot
Match: COPA_STAAM (Copper-exporting P-type ATPase A OS=Staphylococcus aureus (strain Mu50 / ATCC 700699) GN=copA PE=3 SV=1)

HSP 1 Score: 172.17 bits (435), Expect = 2.505e-42
Identity = 89/219 (40.64%), Postives = 134/219 (61.19%), Query Frame = 1
Query:   58 LTLVASAEASSEHPLAKAVVEYARHFHFFDDPSLNPDGQSHSKESTGSGWLLDVSDFSALPGRGIQCFISGKQVLVGNRKLLNESGITIPDHVESFVVELEESARTGILVAYDDNLIGVMGIADPVKREAAVVVEGLLKMGVRPVMVTGDNWRTAHAVAREIGIQDVMADVMPAGKADAVRSFQKDGSIVAMVGDGINDSPALAAADVGMAIGAGTDIA 714
            L L+A+AE  SEHPLA+A+V YA+                  K+ T    L + + F A+PG GI+  I    +LVGNRKL+ ++ I++P H+   +   E   +T +L+A + +L G++ +AD VK  A   ++ L  MG+   M+TGDN  TA A+A+++GI  V+AD++P  KA  +   Q+ G  VAMVGDG+ND+PAL  AD+G+AIG GT++A
Sbjct:  517 LQLLATAEKDSEHPLAEAIVNYAKE-----------------KQLT----LTETTTFKAVPGHGIEATIDHHHILVGNRKLMADNDISLPKHISDDLTHYERDGKTAMLIAVNYSLTGIIAVADTVKDHAKDAIKQLHDMGIEVAMLTGDNKNTAQAIAKQVGIDTVIADILPEEKAAQIAKLQQQGKKVAMVGDGVNDAPALVKADIGIAIGTGTEVA 714          
BLAST of FC868756 vs. ExPASy Swiss-Prot
Match: COPA_STAA9 (Copper-exporting P-type ATPase A OS=Staphylococcus aureus (strain JH9) GN=copA PE=3 SV=1)

HSP 1 Score: 172.17 bits (435), Expect = 2.505e-42
Identity = 89/219 (40.64%), Postives = 134/219 (61.19%), Query Frame = 1
Query:   58 LTLVASAEASSEHPLAKAVVEYARHFHFFDDPSLNPDGQSHSKESTGSGWLLDVSDFSALPGRGIQCFISGKQVLVGNRKLLNESGITIPDHVESFVVELEESARTGILVAYDDNLIGVMGIADPVKREAAVVVEGLLKMGVRPVMVTGDNWRTAHAVAREIGIQDVMADVMPAGKADAVRSFQKDGSIVAMVGDGINDSPALAAADVGMAIGAGTDIA 714
            L L+A+AE  SEHPLA+A+V YA+                  K+ T    L + + F A+PG GI+  I    +LVGNRKL+ ++ I++P H+   +   E   +T +L+A + +L G++ +AD VK  A   ++ L  MG+   M+TGDN  TA A+A+++GI  V+AD++P  KA  +   Q+ G  VAMVGDG+ND+PAL  AD+G+AIG GT++A
Sbjct:  517 LQLLATAEKDSEHPLAEAIVNYAKE-----------------KQLT----LTETTTFKAVPGHGIEATIDHHHILVGNRKLMADNDISLPKHISDDLTHYERDGKTAMLIAVNYSLTGIIAVADTVKDHAKDAIKQLHDMGIEVAMLTGDNKNTAQAIAKQVGIDTVIADILPEEKAAQIAKLQQQGKKVAMVGDGVNDAPALVKADIGIAIGTGTEVA 714          
BLAST of FC868756 vs. ExPASy Swiss-Prot
Match: COPA_STAA2 (Copper-exporting P-type ATPase A OS=Staphylococcus aureus (strain JH1) GN=copA PE=3 SV=1)

HSP 1 Score: 172.17 bits (435), Expect = 2.505e-42
Identity = 89/219 (40.64%), Postives = 134/219 (61.19%), Query Frame = 1
Query:   58 LTLVASAEASSEHPLAKAVVEYARHFHFFDDPSLNPDGQSHSKESTGSGWLLDVSDFSALPGRGIQCFISGKQVLVGNRKLLNESGITIPDHVESFVVELEESARTGILVAYDDNLIGVMGIADPVKREAAVVVEGLLKMGVRPVMVTGDNWRTAHAVAREIGIQDVMADVMPAGKADAVRSFQKDGSIVAMVGDGINDSPALAAADVGMAIGAGTDIA 714
            L L+A+AE  SEHPLA+A+V YA+                  K+ T    L + + F A+PG GI+  I    +LVGNRKL+ ++ I++P H+   +   E   +T +L+A + +L G++ +AD VK  A   ++ L  MG+   M+TGDN  TA A+A+++GI  V+AD++P  KA  +   Q+ G  VAMVGDG+ND+PAL  AD+G+AIG GT++A
Sbjct:  517 LQLLATAEKDSEHPLAEAIVNYAKE-----------------KQLT----LTETTTFKAVPGHGIEATIDHHHILVGNRKLMADNDISLPKHISDDLTHYERDGKTAMLIAVNYSLTGIIAVADTVKDHAKDAIKQLHDMGIEVAMLTGDNKNTAQAIAKQVGIDTVIADILPEEKAAQIAKLQQQGKKVAMVGDGVNDAPALVKADIGIAIGTGTEVA 714          
BLAST of FC868756 vs. ExPASy Swiss-Prot
Match: COPA_STAA1 (Copper-exporting P-type ATPase A OS=Staphylococcus aureus (strain Mu3 / ATCC 700698) GN=copA PE=3 SV=1)

HSP 1 Score: 172.17 bits (435), Expect = 2.505e-42
Identity = 89/219 (40.64%), Postives = 134/219 (61.19%), Query Frame = 1
Query:   58 LTLVASAEASSEHPLAKAVVEYARHFHFFDDPSLNPDGQSHSKESTGSGWLLDVSDFSALPGRGIQCFISGKQVLVGNRKLLNESGITIPDHVESFVVELEESARTGILVAYDDNLIGVMGIADPVKREAAVVVEGLLKMGVRPVMVTGDNWRTAHAVAREIGIQDVMADVMPAGKADAVRSFQKDGSIVAMVGDGINDSPALAAADVGMAIGAGTDIA 714
            L L+A+AE  SEHPLA+A+V YA+                  K+ T    L + + F A+PG GI+  I    +LVGNRKL+ ++ I++P H+   +   E   +T +L+A + +L G++ +AD VK  A   ++ L  MG+   M+TGDN  TA A+A+++GI  V+AD++P  KA  +   Q+ G  VAMVGDG+ND+PAL  AD+G+AIG GT++A
Sbjct:  517 LQLLATAEKDSEHPLAEAIVNYAKE-----------------KQLT----LTETTTFKAVPGHGIEATIDHHHILVGNRKLMADNDISLPKHISDDLTHYERDGKTAMLIAVNYSLTGIIAVADTVKDHAKDAIKQLHDMGIEVAMLTGDNKNTAQAIAKQVGIDTVIADILPEEKAAQIAKLQQQGKKVAMVGDGVNDAPALVKADIGIAIGTGTEVA 714          
The following BLAST results are available for this feature:
BLAST of FC868756 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 258
Match NameE-valueIdentityDescription
AHM5_ARATH3.675e-10275.21Copper-transporting ATPase RAN1 OS=Arabidopsis tha... [more]
AHM7_ARATH1.673e-5445.80Putative copper-transporting ATPase 3 OS=Arabidops... [more]
COPA_STAS11.202e-4441.77Copper-exporting P-type ATPase A OS=Staphylococcus... [more]
CTPV_MYCTU2.960e-4340.51Probable cation-transporting ATPase V OS=Mycobacte... [more]
COPA_STAAR2.505e-4240.64Copper-exporting P-type ATPase A OS=Staphylococcus... [more]
COPA_STAAN2.505e-4240.64Copper-exporting P-type ATPase A OS=Staphylococcus... [more]
COPA_STAAM2.505e-4240.64Copper-exporting P-type ATPase A OS=Staphylococcus... [more]
COPA_STAA92.505e-4240.64Copper-exporting P-type ATPase A OS=Staphylococcus... [more]
COPA_STAA22.505e-4240.64Copper-exporting P-type ATPase A OS=Staphylococcus... [more]
COPA_STAA12.505e-4240.64Copper-exporting P-type ATPase A OS=Staphylococcus... [more]

Pages

back to top
Properties
Property NameValue
Genbank descriptionC31004D06EF AbioticL1 Citrus clementina cDNA clone C31004D06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868756 ID=FC868756|Name=FC868756|organism=Citrus clementina|type=EST|length=715bp
GGGAGAGCTACTGTTACAACTGCTAAGGTTTTCACGAAAATGGATCGTGG
TGAATTTCTTACATTGGTGGCTTCAGCAGAGGCTAGCAGTGAACATCCAT
TGGCCAAAGCAGTTGTGGAGTATGCACGTCATTTCCATTTCTTTGATGAT
CCCTCTTTGAACCCCGATGGCCAAAGCCACAGCAAAGAGTCCACTGGTTC
TGGATGGCTTCTTGATGTCTCGGATTTCTCTGCTCTGCCTGGAAGAGGTA
TCCAGTGCTTTATAAGTGGAAAACAGGTTTTGGTGGGTAACCGGAAGTTG
CTGAATGAAAGTGGAATCACCATTCCAGACCATGTAGAAAGTTTTGTTGT
GGAACTGGAGGAAAGTGCTAGGACGGGCATACTTGTTGCGTATGATGATA
ACTTGATCGGTGTTATGGGAATTGCTGACCCAGTTAAGAGGGAAGCTGCT
GTAGTTGTAGAGGGCCTTTTAAAAATGGGTGTGAGACCCGTCATGGTAAC
TGGAGATAATTGGAGGACAGCGCATGCTGTTGCTAGAGAGATCGGCATTC
AAGATGTGATGGCAGATGTAATGCCAGCAGGAAAAGCTGATGCCGTCCGC
TCATTTCAGAAAGACGGAAGCATAGTAGCTATGGTTGGGGATGGAATCAA
TGATTCTCCAGCTCTAGCTGCGGCTGATGTTGGTATGGCTATTGGGGCAG
GTACAGATATTGCCA
back to top