FC868793

Overview
NameFC868793
Unique NameFC868793
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length393
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC31004H02EF AbioticL1 Citrus clementina cDNA clone C31004H02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868793 ID=FC868793|Name=FC868793|organism=Citrus clementina|type=EST|length=393bp
CTAAAAGCCATGGAGATAATAGCAGGAACAACTGCTACAACTATGGCTAC
CCAATCCATTACTCCAAAAGGCCTCAAATTTGACCCGCCTTTCTCTTTGC
TTCACTCTCAATCTTATGCACCAATTCGAACTTCGCTTCAATATTCCATT
ATTTCTCGGAAACCTCGCATCACCACTCGCTCTATCGCTGACGACACTAC
TTCCAATACTGTGACAAAGGTTGCAGCAGAGGATCCATCTTTCGCGGTAA
AGAAGAAAGCAGCTGATATATCAACCGAATTGAAAGGAACTTCCGTATTT
CTTGTGGGGATGAACAATGCAATAAAAACCCACTTGGGGAATTTTCTTGC
AGATGCATTACGATATTATTACTTTGACAGTGATAGTTTGGTA
back to top