FC868813

Overview
NameFC868813
Unique NameFC868813
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length635
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig651 contig Ccv1_Contig651:13..647. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC31005B01EF AbioticL1 Citrus clementina cDNA clone C31005B01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868813 ID=FC868813|Name=FC868813|organism=Citrus clementina|type=EST|length=635bp
TTCCCGGGGATGAGAGAAGTAGCCCTCAAATTCTCGTCCCAAACAAAATG
ATTTTCCTACTACTCCTTTCAATTTTTCTTCCCAGTGCTTCTTCATCAAT
CCCTGTGGATCCACCTGTTAGCTTCTCATTTTCCTCATTCAACCCAAAAA
GTTGTAGCGATGGCAGCCTAATTTGCATGGGCGCAGTGACTCCAAGTTAT
GGCTACTTGAGCCTCACATCAGACCCTTCACCAGAATCGCCTGATCAGCT
GCCGCTAAAAAAGGTTGGACGGGTTTTATACAGCCAGCCTGTGACTGCAT
GGCCAGCTATGATTAGTACCACCTTCACCATTAGGATCTCACCCTACCCA
AATACAACGGATTCTGCAGATGGCATGACGTTTGTTTTTGCAACCGATAC
CAGCCCTCCAACTGAAAACTCCGCCGGCGGAAATCTTGGACTGAGTAACG
GTGTTTCGCAATTAGCCGTGGAGCTGGACACTTACAAGAACGACTACTGG
TCTGATCCAGATGCTAACCATATGGGCATTGACATAGCAAACTTAACATC
GAATCCAGCCAAGAGTCTCGACAGCTCTGGTATTGATCNTCAAAGTGGAA
GACCGATCCAGGTTCACATTTATTACGATGGATGG
back to top