FC868977

Overview
NameFC868977
Unique NameFC868977
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length621
Libraries
Library NameType
AbioticL1cdna_library
Properties
Property NameValue
Genbank descriptionC31007B12EF AbioticL1 Citrus clementina cDNA clone C31007B12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868977 ID=FC868977; Name=FC868977; organism=Citrus clementina; type=EST; length=621bp
TTTTTTTTTTTTTTTTTTTTAATTTTTTCACAGATTACATTCATTTGGAC
CATCACAAATTTTACTTTTGTTTACATTTAATTTCATTTCTTTCTCTCTC
TGTGTCTTTTCCTTTCCTCTCATCTCGTCCATGGCTGATGGCTCCCCAGT
TTCTTGTTCTGGTCTCTGTTTAATTTCCATTATCATTATTCTTCATCTCT
TCTCTCTTTTATTTGGTAAAAAATTACAATAAAAAAGTAACTGAAAGAGA
GTAACACCCCCCCCCCCCCCCCCCCAACACACCAAAAAAAAAAAAAAGAA
ACAAATCCCCACAAAAATTTCCAACAAAACTCAATGAAACGCTTCTGGGT
TTCTAATTCTTTCAGGAATTAGTGACCCCATTTCATTTCTTGGTTTCGTC
GATCTTCTCTCTGTCTCTTTCAGCTATCATTCGAATCGACGGTCATCCTT
TCATCCCTTGGGTGCTGTAACTTGTCCTCCCATTTGTGTTTGAAATTTGG
ATCATTGTTTAGCATTGTGTTCACTCGTTCTGGTTGGAATATTTTCCCCG
ATGCAAGGTCAAGGGAGTACCATTGATTCTTTCCCTGAATCTGTTAATAT
TGATCAGGATTCTGTTTCCAG
back to top