FC869041

Overview
NameFC869041
Unique NameFC869041
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length704
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC31007H05EF AbioticL1 Citrus clementina cDNA clone C31007H05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC869041 ID=FC869041|Name=FC869041|organism=Citrus clementina|type=EST|length=704bp
GATGATCATAAGCTAAAAAACTGCCACTCTCACTCAAAATTCATCATCAA
TGGCTCATTTGGCAAACTTAAATGGTGTTTCTGAAACCTTACCAGCCGTC
CCAAACCTGCCTAAGTTTCAAAAATTCCAAAAGAGAGCTAAAATAATTGG
ACTTCTAGGCCACAAAGCAGAAAACTTTCAAGACCAGGCACAAATTACAA
GAAGAGTGTCACTAGGCCTTGCCTCTTTAGCACTTATTGGAAGCACTTCT
AGCAATGGAGCGTCTCTTGCTGAGGATAATGGCCTCTGGGTCACTGGCCC
TTTACCTGTACCTCCTGTATACAACAATATTGCTAGTGAGAAAACGGGCA
CACGTTCTTTTCTAAAGAAAGCAATCTATATTGCAAATATTGGAACCAAA
GGCAGGATTCATAGGCTAAAAAGATATGCATTTGACCTGCTGGCAATGGC
AGATTTGATTGGACCAGATACTCTTAATTATGTGAGAAAGTATTTGAGAC
TCAAATCTACTTTCATGTACTATGATTTTGACAACGTCATCTCCGCAGCA
GCACCCAGTGATAAGCAACCTCTCACTGATTTGGCTAACAGATTATTTGA
CAGTTTTGAGAAGCTTGAAGTTGCCGTAAGTACCAAAAATTTCCCACAGA
CACAATCAACTTATGCAGATACTGCTGTTATTCTTCATGAGGNTATGGAT
CGAA
back to top