FC869196

Overview
NameFC869196
Unique NameFC869196
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length604
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC31009E10EF AbioticL1 Citrus clementina cDNA clone C31009E10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC869196 ID=FC869196; Name=FC869196; organism=Citrus clementina; type=EST; length=604bp
CATGCCTTCTGTGCTGAGTGGGTCTTTGAGTCAACATTTAGAAGGGGACA
AGTAAATCCTGTAGCAGGAATGGAGGCATTTCCAAAGGGGATTGATGTTT
GTTGTATTTGCCGGCACAAACATGGCATCTGCATAAAGTGTAACTATGGT
AACTGTCAGACCACATTTCACCCTACTTGTGCTAGAAGTGCTGGTTTCTA
TTTGAATGTTAAGTCTACTGGTGGCAATTTCCAACACAAGGCTTATTGTG
AAAAGCATAGCTTGGAGCAGAAGATGAAGGCTGAAACTCAGAAGCATGGG
GTTGAGGAATTAAAAGGCATTAAGCAAATTAGGGTCGAGCTAGAGAGGTT
GCGCCTTCTTTGTGAGAGAATTATCAAACGGGAAAAAATAAAGCGGGAAT
TGATTCTTTGCTCGCATGAGATTCTTGCTTTCAAAAGAGACCACCATGCT
GCTCGTTTGGTGCATGGTCGCATTCCCTTTTTCCCACCAGACGTTAGTTC
AGAATCAGCTACAACATCCCTTAAAGGTCATACCGACAGTTTTAAGTCAT
GCAGTGAAGCTTTCCAACGTTCAGATGATGTGACTGTGGATAGCGCTGCT
TCTG
back to top