FC872969

Overview
NameFC872969
Unique NameFC872969
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length675
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Libraries
Library NameType
AbsDevcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAI2BA01FM1 AbsDev Citrus clementina cDNA clone KN0AAI2BA01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC872969 ID=FC872969|Name=FC872969|organism=Citrus clementina|type=EST|length=675bp
CAAAGTTCCGGCCTTTTTCCGGGAAGAAGTACTCATTGCCTGGTTGATTA
TTTTATTGGAGGGCCAGGATTTATTGCCTTTAGGCCGTCAGTCCCCTTTA
CTTGTCCTTTATGGATATGATAGATTCCTTTCTTGCGATTAACGAAATGT
TGATGTATGAACTATTGCTCCTTAAACCTATTTTGGCGATCTGGAGGTAA
AATTAACCTATTTCGTATGACTGTAATACCAATCGATGTCTGTCGAGTAT
TTTCTTCCAGGAAACAAGCAGACTCTCATCACCATATGCAATGACAAGGA
CTTATAAAGGATGTTTGATTTTCATGAATGCTCAGTGACGGCAGATGTCT
TTGTTATAGGAACATCGGGTTTTGATCGTGAAGCCTTTGCCATCGAAACT
GGCAGGGCAAGTGGGATAAAACTAGCTGAAACTGTGTCTCCGTCTAAGGC
GTCTAAAGCACTTGTTACAACTGATCCTGTATCAACACCTGCTGGACCTA
GTGCGGCTAATCTTACTCCCAATAGTCTTGCTGACCCTGCTGATGGAACT
GCTCACAGCCCAATTACATATGATGTGAGTGCTACTCCTGCAGATACTGT
TAAGAAGCGAAGGCGTGCAGCCTCCAGGAAGAACAGTACCGATGCTCCTA
CTGCTGCAGTCACTAAAACTGTTCG
back to top