FC875274

Overview
NameFC875274
Unique NameFC875274
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length722
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10195 contig Ccv1_Contig10195:1..722. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
CTVClemen1cdna_library
Properties
Property NameValue
Genbank descriptionC31402B06EF CTVClemen1 Citrus clementina cDNA clone C31402B06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC875274 ID=FC875274|Name=FC875274|organism=Citrus clementina|type=EST|length=722bp
GATTTCGTTGACTAAAAAAGACTCCTTAAAGGTTAAGGTCAATACCGTCC
TTGGCTCACATGCTCCTCCTCTAACAGTGACACTTGTGCGAGCATTTTCC
TCTAGTGCAAGGGACAATTCCATAATTGAGAACCAGGAACTCAAATTTGA
CCCTCAGGATGCAGTTTATTTCTTGGATGATCTGCCAGCAAGTTTTGATG
TGGGAGAGTACATTTTTGTTTTTAAGATGTTGGTTCAAGATTCTGAGCAA
CAAACTGTTTATGCCACTGGAACTCTAACTCAAGTACCAATTTACGTGAC
GGGACTTATCAAAATCGAAAATGCTAAAATTGCAGTTCTTGATAGTGATC
TTGGGAGTGTGGAAACACAAAAAAAGCTAGATTTAGCTGGAGAAAGTACT
GTGTCAGTATCAGCAAACCACCTGCAGAAGCTGCGTCTGTCATTTCAAAT
GTCCACCCCTCTTGGCAATGCTTTTAAGCCACATCAGGCATTTCTCAGGC
TGAGACATGAGACAAAGGTTGAGCACACCTTTGTAGTCGGGAGCTCTGGG
AAAAAGTTTGAGATAACTCTAGATTTTCTAGGACTTGTTGAGAAGTTCTT
CTATCTCTCAGGTAGATATGACATTCAGCTAACTGTTGGTGATGCTGTCA
TGGAGAACTCTTTATTACGTGATATTGGCTATGTCGAATTAGATCTACCA
GAACCTCCNTGAGATGCATCCC
back to top