FC876461

Overview
NameFC876461
Unique NameFC876461
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length679
Alignments
Feature NameTypeLocationAnalysis
FC876461_ssr556 microsatellite FC876461_ssr556:556..571.
FC876461_ssr274 microsatellite FC876461_ssr274:274..291.
FC876461_ssr451 microsatellite FC876461_ssr451:451..462.
Ccv1_Contig15042 contig Ccv1_Contig15042:368..1048. BLAST: Citrus Unigene V1 Contigs to Trembl
Libraries
Library NameType
EHRcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAN2CA10RM1 EHR Citrus clementina cDNA clone KN0AAN2CA10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC876461 ID=FC876461|Name=FC876461|organism=Citrus clementina|type=EST|length=679bp
GATAGCAAACAACTCTTTGTATTGAAAAGAAAAGAAGAGGAACAGTCGTT
TTAAGGGAAAATGTCAGGAGTTATTCACAAGATCGGAGAAGCCCTTCACA
TGGGAGGAGGGCAAAAGGAGGAGGACAAGCACAAGGGTGAGCACCATAGT
GGGGACCACCACACTACTGATGTTCACCATCAGCAGCAGTATCACGGCGG
CGAACACAAGGAGGGCTTGGTGGACAAGATCAAGCAGCAGATCCCCGGTG
TCGGTACTACTGATGTTCACCATCAGCAGCAGCAGCAGCAGTATCACGGC
GGGGAACACAGGGAGGGCGAACACAAGGAGGGCTTGGTGGACAAGATCAA
GCAGAAGATCCCCGGTGTCGGCGGCGGCGAGGGCGCCGCCCACGGTGAAG
AGAAGAAGAAAAAGAAGAAGGAGAAGAAGAAGCACGAGGACGGACACGAG
AGCAGCAGCAGCAGTGACAGCGATTAAATTAATTAACTTTTATGTGACGC
ATCAACATCAGCATCATCATCCATCATCTTAGATTTATTCTATAATAAAA
ATTTGGTGTGTGTGTGTGTGTGGTCACAGTAAGAGCTTGCTGCTTTATTT
TTGGGGTGTCTACTCAAGGTGGTGTTGTGTTTAAATTATTATTGCTTTTG
AAAGACTCTGTTTTTTTTTTANAAAAAAA
back to top