FC876469

Overview
NameFC876469
Unique NameFC876469
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length733
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC876469_ssr470 microsatellite FC876469_ssr470:470..481. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig9683 contig Ccv1_Contig9683:375..1107. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
EHRcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAN2CB06RM1 EHR Citrus clementina cDNA clone KN0AAN2CB06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC876469 ID=FC876469|Name=FC876469|organism=Citrus clementina|type=EST|length=733bp
GCACGAGGAAACCCCTTATCATATATTTTCTGATCTCTCTCTTTTACCCT
TATATATCTATACATACATTTTTTATTTGATCTCTCGTTTTATATAATTT
GGACTAGCTGCGAGAGTATCATGGGGGAGTCTTCTGCTTCTTACATACAC
ATGGTGCAGCACTTGATAGAGAAGTGTTTGATATTCCGCATGACAAAAGA
AGAATGCATGGAAGCTCTCTCTAAACATGCAAATATCAAACCTGTCATCA
CCTCCACTGTTTGGAATGAATTAGAGAAAGAAAACAAAGAGTTCTTCGAG
GCATACGCTCAATCTCAAAGCAAAGAAGATCGAATGTCCGAGGAAGAGAC
GAGTCAAATGATCCAGAAGATGATCTCCACTAATTCCTCCAATTCTCAAA
ACGACGACGACCAAGATTAAACTTAATTCCCCTAGCGAAGAACTCTTTGA
AAACAATATATAGGTATAGATATATATATATGTATGTATATATCCTCTCT
CGCTCTCAAATAATTAATTTAGCCAAAATAGTAACAACTCTCGCCAATGT
TGGTCCCTTTAGCTCAAGCTTAGTGTTATACTTATATTGAACCAATCAAA
CAAAAGGGTCATCCTGTAATTCCGAATTGACATCAATGTGGTGAAATTTG
ATTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top