FC877784

Overview
NameFC877784
Unique NameFC877784
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length882
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10665 contig Ccv1_Contig10665:360..1241. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
IVIA1cdna_library
Properties
Property NameValue
Genbank descriptionIC0AAA24CC03RM1 IVIA1 Citrus clementina cDNA clone IC0AAA24CC03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC877784 ID=FC877784|Name=FC877784|organism=Citrus clementina|type=EST|length=882bp
ATAACTATGGAATTTTGGTAAACGCTTTTGTAATTTTGAAGTACTCCTGA
ATTTCTGTGTCGATTCGGTTCGCTGATCTCGCTAGAAGAAAGAGAGGTTG
ATACTGTCGATGACTTGGTAGAGTAGTAGGAGCCTCACTTTTTTCGGTTT
ATAAAATTTTGTCTTTTAAGCGTAATCACATTTTGAGAAGAGTAGTCTAG
AGATTGGCTGCAATTGTTTAGAAGCTGGAGTGAAATGGAGGAGATGATTC
GATAATCTCGTGAGTTCGGTTTTTGGTGATAGTTGTTCTGATCAACGGTG
AGCATTAATTATGCCTTTTCCGATGAAGATCCAGCCAATTGATTCTCATT
CGCTGGAAGAACCGACTCGGTTCGAGCCGGCAAAGCCAGTAGCGAAGTCG
CGACTCAAGCGGCTCTTCGAGCGCCAATTCTTGAGAAACTCTTCCCCAGC
GGAGAAGGTCGAGGAGCCGGTGCATGTCAACAAAGAGGTCTCCAACGGCG
GTTCGGCTGCGGCTGAGTTCGAGCCTAGCTCGGTCTGCTTAGCAAAGATG
GTTCAGAACTTCATCGAGGAGAACAACGAGAAGCAATCCGGTGGTGCAAT
CAAATGTGGCCGCAACCGCTGCAACTGCTTTAATGGAACCTGTAACGAGA
GCTCTGAAGATGAATTGGACTCTTACTACGGTGATTCTAACCTCGCTTCC
TCTGCCGAAGCCTGTGAAATTCTTAAGAGTTTGGTGCCTTGCGCGAGTGT
TAGCGAGAGGAATTTACTAGCGGACACGGCGAAGATTGTAGAGAAGAATA
AGATCTGTAAACGTAAAGACGATGTTTGCAGGAAGATTGTGACTGATGGA
TTATTGGCTCTCGGATACGATGCCTCTATCTG
back to top