FC877792

Overview
NameFC877792
Unique NameFC877792
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length843
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15409 contig Ccv1_Contig15409:234..1076. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
IVIA1cdna_library
Properties
Property NameValue
Genbank descriptionIC0AAA96BA11RM1 IVIA1 Citrus clementina cDNA clone IC0AAA96BA11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC877792 ID=FC877792|Name=FC877792|organism=Citrus clementina|type=EST|length=843bp
CTTTCATCAATTCAGAATCCACCAAATCCCTTGCGTTGAGTCTGTTTTTG
TTCCTGATACTTGTCGGCCCAACGCCGTCATTCGCCCGAACCCCACACGT
TATCAATTTCCGCTCACTGAATCGCTACCCAGAGGGTCTGACGTGGGACC
CATCAGCCCAGCACTTCGTCGTCGGCTCTCAGCACCATCGCACAATCCAC
TCCGTCTCCGATGCCGCCGTCGTCGAAACCCTTATCTCCGACCCAACTCT
TCCCGAAAACGCCACCATTTTGGGTCTCGCCATCGACTCAATCCACAACC
GCCTCCTCGCCCTCGTTCACTCTGCCGCGCCCCTTCCTCCCTTCAATGCC
CTCGCCGCATACGACCTCCGATCGCGCCGCCGCGTCTTCCTGTCTCTACT
CGACGACGAAACCCCTGGTGTCATAACCATCAAGCGCCACGTGGCGAACG
ACGTGGCTGTGGATTTCAATGGGAACGCTTACGTCACGAACTCCGCCGGG
AACTTCATCTGGAAGGTGGACAAAGACGGCGAGGCCTCGGTCTTCTCGAG
ATCTCCTGTTTTCAGCGAGAGTCCCTTGGCGGTTGACCCCGACGCGCCGT
TTAGCGAGTGTGGATTAAACGGGATAGCTTACGTGAGCAAGGGGTATTTG
CTCGTGGTGCAATCCAATACGGGCAAGATGTTTAAGGTCAACGCGGATGA
CGGGTTGGCTAGGCGGGTTTTGTTGACCGAGGATTTGGTTTGGGCCGACG
GTATAGCCGTTAGAAGCGACGGCGTCGTTTTGGTGGTGTCTCATCACACG
TTGTGGTTTATTAAGTCTCACGATAGTTGGGCCGAGGGAGTAG
back to top