FC877892

Overview
NameFC877892
Unique NameFC877892
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length904
Libraries
Library NameType
IVIA1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC877892_ssr35 microsatellite FC877892_ssr35:35..46. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig11082 contig Ccv1_Contig11082:25..920. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionIC0AAA100AD04RM1 IVIA1 Citrus clementina cDNA clone IC0AAA100AD04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC877892 ID=FC877892|Name=FC877892|organism=Citrus clementina|type=EST|length=904bp
GAGTGAGAGACAGAATGAGGGCAGGAATGACGGTGGCGGCGGCGGCCGTG
CTGCTGGTTGCCATGACGATTCTGGTGCCGGAGGTGGATGCAACTAGATG
GATTGTGGGAGCCAACCAAGGTTGGACCAATAACGTGAACTATACCATAT
GGGCAAAAGATAAGCACTTTTACAATGGCGACTGGCTTTGTAAGTTCTTC
TCTCTTTGCTTGTCTTAAGATCTGTTCTTTACTTGCTTTGAGTTGCCGGT
GACTTCGAGCTTATTGGGTTTTTTTTTTTTCTGCATGGAATTCGGCTTTG
GATCGGTTCTTTTGTATGTTGTTTAAGATTTGGGGCTCCTTTAGCTGCTG
TTTATTATGTCGTAGTGATTTGTGTGAGTGAGTGGCGATGGCAAAGCTCA
TATTGTTTAATTTTAGTCCTCTTTTTTCGTCTGTTTGCTTTTGAAGCTAA
ATTTGTTAGATCTACTAATGCTTGAAGTGAGTTGATACTCTTGAAATTTT
GTGTTTCTTGTTTGTTCTGTGTTTGCTCGTTTTAATCTTTTGTTAAGTTC
AAGTTTGTGGCCTTTAGCAGTTTTAGTTTGTTGGCATTGAAGAAGAAAAC
GGTTGATTTCCTATGATTTTGTCAGTAGGGTAGCTATGTTTGTGTTAAAA
ATAACAACTTGGTCGTGGATTGTAAATATTGAGACTACTTCTTCCATCGA
GACATTGAGCGCTAATGGAAAACTTGAGAAAGTGGGAAAAGTAGATATGT
AAGAAGCTGTTGTGAGTGCTTGTTCGGTTTTGATTTCTCCTTTCATTTGT
TTTCTCTGCAATTATGGTTTACCAAGATCGGGAGATTTTGCTTGATGCTC
TCAGTTCTTTTCGCTGTGGAGATGAATTCTCTCAATCTCTCTTCATACTC
ACCT
back to top