FC877898

Overview
NameFC877898
Unique NameFC877898
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length878
Libraries
Library NameType
IVIA1cdna_library
Alignments
Feature NameTypeLocationAnalysis
FC877898_ssr787 microsatellite FC877898_ssr787:787..798.
Ccv1_Contig10473 contig Ccv1_Contig10473:1..878. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionIC0AAA100AD05RM1 IVIA1 Citrus clementina cDNA clone IC0AAA100AD05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC877898 ID=FC877898|Name=FC877898|organism=Citrus clementina|type=EST|length=878bp
CACTTTTTGAAGAGGACAAAAAAAGTCCTAAATAAGTAATAAAAGAGTTA
CAAAACATACAAAACGTGGAAGACAAGAATTACGCGCTGCGTCCTGCCCC
GCGCCGCTGCGTCGGAATCTTCTTGTTATTATTTATAAAGAATTTGTGGT
CGCTTCTTGATATTAAAAAAACCCATCAATATGTCCGCGCGTTCATCATC
AGGGGAGAATGAGATCGCTGGTGGTGATGCAGAAAAAGAGAATGTGATTA
AGGTGTTTAAAGATAATGGGTTGGAGAATTGTTTGGGTGGGGATGCTTCT
GATACAGAAGAAGTCTTTAGAATTTGTAGCGTGTTCGGCGTGGATCAAAT
AGTGAATGCGATGAAAGCCTTTGTGCCTTCGGGAAGAGTTGATCTTTTGA
AGGCCTTTTTGAAGATTTTTTTGAAGACTACGAAGAGGATTGCCGATGTT
TATGTTGCTGGTGGTCCTAATGCTAGACTAAACTTTTTAAAACTGCAAAA
GAACTTACTTCTCTCCTCGATTCAGGCTTTTGAACAGAAAACACAGGCCG
TGTTCCAGACTTTACATGAGCAACACCAGCAAGAATGGATCAAGTATTTA
CAACGGGTACAACTGCGTCTTGATCGTCTGCAGAGTACTGTGCCGAGCAA
CACGTCTTTGCAAAGTTGGGAGGATCAACAACTGAACGAGTCCCTTGCTA
TTTATGTCAGGCTCCAATGTTTAGCAGTGGAACAGCATATCGTGATGAGG
TTCTTGCAACGGCAACATCACCAGCAAAGCCAGGCCCAGCAGCAGCAGCG
GCAGCAGCCAGCGATGGGATTTTTAGAACAGCGAGTCCAACAACAGCAGC
AAGCCGTGATTGGGTCATTACAACTGCT
back to top